Incidental Mutation 'R6890:Eps8'
ID537153
Institutional Source Beutler Lab
Gene Symbol Eps8
Ensembl Gene ENSMUSG00000015766
Gene Nameepidermal growth factor receptor pathway substrate 8
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.430) question?
Stock #R6890 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location137477245-137654876 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 137512257 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 381 (V381A)
Ref Sequence ENSEMBL: ENSMUSP00000120044 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058210] [ENSMUST00000100841] [ENSMUST00000111878] [ENSMUST00000132920] [ENSMUST00000147526]
Predicted Effect probably damaging
Transcript: ENSMUST00000058210
AA Change: V381A

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000052776
Gene: ENSMUSG00000015766
AA Change: V381A

DomainStartEndE-ValueType
PTB 60 197 8.38e-34 SMART
low complexity region 203 221 N/A INTRINSIC
low complexity region 229 241 N/A INTRINSIC
low complexity region 298 309 N/A INTRINSIC
SH3 533 588 5.48e-14 SMART
low complexity region 620 651 N/A INTRINSIC
Blast:SH3 652 686 6e-6 BLAST
PDB:2E8M|A 698 783 5e-50 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000100841
AA Change: V381A

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000098402
Gene: ENSMUSG00000015766
AA Change: V381A

DomainStartEndE-ValueType
PTB 60 197 8.38e-34 SMART
low complexity region 203 221 N/A INTRINSIC
low complexity region 229 241 N/A INTRINSIC
low complexity region 298 309 N/A INTRINSIC
SH3 533 588 5.48e-14 SMART
low complexity region 620 651 N/A INTRINSIC
Blast:SH3 652 686 6e-6 BLAST
PDB:2E8M|A 698 783 5e-50 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000111878
AA Change: V381A

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000107509
Gene: ENSMUSG00000015766
AA Change: V381A

DomainStartEndE-ValueType
PTB 60 197 8.38e-34 SMART
low complexity region 203 221 N/A INTRINSIC
low complexity region 229 241 N/A INTRINSIC
low complexity region 298 309 N/A INTRINSIC
SH3 533 588 5.48e-14 SMART
low complexity region 620 651 N/A INTRINSIC
Blast:SH3 652 686 6e-6 BLAST
PDB:2E8M|A 698 783 5e-50 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000132920
SMART Domains Protein: ENSMUSP00000122517
Gene: ENSMUSG00000015766

DomainStartEndE-ValueType
low complexity region 54 66 N/A INTRINSIC
PTB 77 214 8.38e-34 SMART
low complexity region 220 238 N/A INTRINSIC
low complexity region 246 258 N/A INTRINSIC
low complexity region 315 326 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000147526
AA Change: V381A

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000120044
Gene: ENSMUSG00000015766
AA Change: V381A

DomainStartEndE-ValueType
PTB 60 197 8.38e-34 SMART
low complexity region 203 221 N/A INTRINSIC
low complexity region 229 241 N/A INTRINSIC
low complexity region 298 309 N/A INTRINSIC
SH3 533 587 4.56e-11 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the EPS8 family. This protein contains one PH domain and one SH3 domain. It functions as part of the EGFR pathway, though its exact role has not been determined. Highly similar proteins in other organisms are involved in the transduction of signals from Ras to Rac and growth factor-mediated actin remodeling. Alternate transcriptional splice variants of this gene have been observed but have not been thoroughly characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in resistance to some of the intoxicating effects of ethanol and increased ethanol consumption. NMDA receptor currents and their sensitivity to inhibition by ethanol are abnormal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130011E15Rik A G 19: 45,960,357 Y228H probably damaging Het
Alg3 T C 16: 20,605,986 T270A possibly damaging Het
Ambp G C 4: 63,150,359 H140Q probably benign Het
Arhgef10 T C 8: 14,928,786 C18R probably benign Het
Arhgef10l A G 4: 140,544,419 F548S probably damaging Het
Cdhr1 T C 14: 37,085,645 D346G probably damaging Het
Col18a1 T A 10: 77,113,484 probably benign Het
Col1a2 T A 6: 4,539,587 L1285Q unknown Het
Cspg5 T C 9: 110,246,784 L196P probably damaging Het
Dusp10 T G 1: 184,069,196 Y387D probably damaging Het
Epb41 A T 4: 131,935,829 D681E probably damaging Het
Fam129c T A 8: 71,605,671 V540D probably damaging Het
Fbxw16 A T 9: 109,436,742 S336R probably benign Het
Gm49368 A G 7: 128,081,729 R277G probably benign Het
Gsg1 C T 6: 135,237,420 V320I probably benign Het
Iglc3 T A 16: 19,065,508 probably benign Het
Klc4 A T 17: 46,631,843 N598K probably benign Het
Malsu1 A G 6: 49,075,251 Y135C probably damaging Het
Mapkbp1 T C 2: 120,015,802 I477T probably damaging Het
Mtss1 G T 15: 58,951,659 S286R probably damaging Het
Naip2 A C 13: 100,162,041 S496A probably benign Het
Npepps A T 11: 97,267,644 C98* probably null Het
Nphp3 A C 9: 104,041,954 Y1267S probably damaging Het
Npr3 A G 15: 11,883,392 V317A possibly damaging Het
Nsun6 A G 2: 15,048,977 I7T probably damaging Het
Olfr1342 A G 4: 118,689,531 V307A possibly damaging Het
Olfr1480 C T 19: 13,530,081 T180I probably damaging Het
Olfr632 A T 7: 103,937,859 T160S possibly damaging Het
Pcnx A G 12: 81,971,376 H1330R probably benign Het
Rad17 T C 13: 100,637,084 I201V probably benign Het
Slc26a4 G A 12: 31,549,951 T126M possibly damaging Het
Slitrk6 A T 14: 110,751,096 L393* probably null Het
Snx2 A G 18: 53,212,879 H378R probably damaging Het
Tex21 A G 12: 76,239,455 probably null Het
Trio A T 15: 27,919,288 probably benign Het
Vpreb2 T C 16: 17,980,956 I102T probably damaging Het
Zfp617 T G 8: 71,932,166 H113Q probably benign Het
Zgpat T A 2: 181,378,511 I237N probably damaging Het
Other mutations in Eps8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Eps8 APN 6 137505479 missense probably benign 0.00
IGL00499:Eps8 APN 6 137522888 nonsense probably null
IGL01587:Eps8 APN 6 137514713 missense probably damaging 1.00
IGL01789:Eps8 APN 6 137539366 missense probably benign 0.01
IGL01836:Eps8 APN 6 137483541 critical splice donor site probably null
IGL01951:Eps8 APN 6 137537671 missense possibly damaging 0.66
IGL02478:Eps8 APN 6 137522842 missense probably benign 0.05
IGL02546:Eps8 APN 6 137479066 missense probably benign 0.30
IGL02861:Eps8 APN 6 137499599 missense probably damaging 1.00
IGL03115:Eps8 APN 6 137527381 missense probably damaging 1.00
IGL03355:Eps8 APN 6 137512145 splice site probably benign
FR4589:Eps8 UTSW 6 137517069 frame shift probably null
R0113:Eps8 UTSW 6 137537684 missense possibly damaging 0.87
R0245:Eps8 UTSW 6 137479128 missense probably benign 0.01
R0462:Eps8 UTSW 6 137514311 missense probably benign 0.00
R0905:Eps8 UTSW 6 137514307 missense probably benign 0.23
R1106:Eps8 UTSW 6 137514324 missense probably damaging 1.00
R1178:Eps8 UTSW 6 137522854 missense possibly damaging 0.46
R1181:Eps8 UTSW 6 137522854 missense possibly damaging 0.46
R1448:Eps8 UTSW 6 137522854 missense possibly damaging 0.46
R1612:Eps8 UTSW 6 137500618 missense probably benign 0.00
R1835:Eps8 UTSW 6 137522279 nonsense probably null
R2068:Eps8 UTSW 6 137522174 missense probably benign 0.13
R2113:Eps8 UTSW 6 137537635 splice site probably null
R2943:Eps8 UTSW 6 137522872 missense probably damaging 1.00
R3032:Eps8 UTSW 6 137512177 missense probably damaging 0.96
R3879:Eps8 UTSW 6 137527362 splice site probably benign
R3973:Eps8 UTSW 6 137509155 missense probably benign 0.00
R4199:Eps8 UTSW 6 137514327 missense probably damaging 0.96
R4384:Eps8 UTSW 6 137499592 missense probably benign 0.30
R4728:Eps8 UTSW 6 137509162 nonsense probably null
R4840:Eps8 UTSW 6 137527130 missense probably damaging 1.00
R4860:Eps8 UTSW 6 137514295 missense probably damaging 0.97
R4860:Eps8 UTSW 6 137514295 missense probably damaging 0.97
R4864:Eps8 UTSW 6 137478969 utr 3 prime probably benign
R5197:Eps8 UTSW 6 137490290 missense probably damaging 0.97
R5197:Eps8 UTSW 6 137490291 missense possibly damaging 0.91
R5214:Eps8 UTSW 6 137527492 missense probably damaging 0.99
R5457:Eps8 UTSW 6 137512177 missense probably damaging 0.96
R5464:Eps8 UTSW 6 137527475 missense probably damaging 1.00
R5557:Eps8 UTSW 6 137479096 missense possibly damaging 0.90
R5981:Eps8 UTSW 6 137482210 missense probably damaging 0.98
R6150:Eps8 UTSW 6 137517174 missense probably damaging 1.00
R6473:Eps8 UTSW 6 137479098 missense probably damaging 1.00
R6529:Eps8 UTSW 6 137514337 missense possibly damaging 0.92
R6574:Eps8 UTSW 6 137483598 nonsense probably null
R7180:Eps8 UTSW 6 137479074 missense possibly damaging 0.78
R7229:Eps8 UTSW 6 137539356 missense probably benign
R7314:Eps8 UTSW 6 137527092 missense possibly damaging 0.51
R7336:Eps8 UTSW 6 137509213 missense possibly damaging 0.75
R7784:Eps8 UTSW 6 137499587 missense probably benign 0.01
R7942:Eps8 UTSW 6 137530577 missense possibly damaging 0.53
R7988:Eps8 UTSW 6 137528571 missense possibly damaging 0.95
R7989:Eps8 UTSW 6 137528571 missense possibly damaging 0.95
R7991:Eps8 UTSW 6 137528571 missense possibly damaging 0.95
R8235:Eps8 UTSW 6 137483578 missense possibly damaging 0.62
R8262:Eps8 UTSW 6 137482254 missense probably benign 0.10
R8902:Eps8 UTSW 6 137512177 missense probably damaging 1.00
RF025:Eps8 UTSW 6 137517066 critical splice donor site probably benign
RF028:Eps8 UTSW 6 137517063 critical splice donor site probably benign
RF035:Eps8 UTSW 6 137517070 frame shift probably null
RF039:Eps8 UTSW 6 137517070 frame shift probably null
RF046:Eps8 UTSW 6 137517063 critical splice donor site probably benign
RF057:Eps8 UTSW 6 137517064 critical splice donor site probably benign
Z1177:Eps8 UTSW 6 137499581 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ATGCCTTACTGTTTAGTGCACAG -3'
(R):5'- CCTCATTCTGGATAACTCAGTTTG -3'

Sequencing Primer
(F):5'- CCTTACTGTTTAGTGCACAGACAGG -3'
(R):5'- TGCAAACAGCACTTTGT -3'
Posted On2018-10-18