Incidental Mutation 'R6890:Gm49368'
ID537155
Institutional Source Beutler Lab
Gene Symbol Gm49368
Ensembl Gene ENSMUSG00000108596
Gene Namepredicted gene, 49368
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R6890 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location128062683-128128160 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 128081729 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 277 (R277G)
Ref Sequence ENSEMBL: ENSMUSP00000101847 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064821] [ENSMUST00000098015] [ENSMUST00000106240] [ENSMUST00000106242] [ENSMUST00000120355]
Predicted Effect probably benign
Transcript: ENSMUST00000064821
AA Change: R277G

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000068468
Gene: ENSMUSG00000030786
AA Change: R277G

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Int_alpha 30 80 8.11e0 SMART
VWA 148 333 2.63e-49 SMART
Int_alpha 400 449 1.07e1 SMART
Int_alpha 453 510 1.48e-7 SMART
Int_alpha 516 572 4.9e-13 SMART
Int_alpha 579 633 3.67e-3 SMART
low complexity region 849 855 N/A INTRINSIC
Pfam:Integrin_alpha 1130 1144 2.1e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098015
AA Change: R277G

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000095625
Gene: ENSMUSG00000108596
AA Change: R277G

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Int_alpha 30 80 8.11e0 SMART
VWA 148 333 2.63e-49 SMART
Int_alpha 400 449 1.07e1 SMART
Int_alpha 453 510 1.48e-7 SMART
Int_alpha 516 572 4.9e-13 SMART
Int_alpha 579 633 3.67e-3 SMART
low complexity region 849 855 N/A INTRINSIC
coiled coil region 1143 1170 N/A INTRINSIC
low complexity region 1178 1200 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106240
AA Change: R277G

PolyPhen 2 Score 0.242 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000101847
Gene: ENSMUSG00000030786
AA Change: R277G

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Int_alpha 30 80 8.11e0 SMART
VWA 148 333 2.63e-49 SMART
Int_alpha 400 449 1.07e1 SMART
Int_alpha 462 516 3.67e-3 SMART
low complexity region 732 738 N/A INTRINSIC
Pfam:Integrin_alpha 1013 1027 3.9e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106242
AA Change: R277G

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000101849
Gene: ENSMUSG00000030786
AA Change: R277G

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Int_alpha 30 80 8.11e0 SMART
VWA 148 333 2.63e-49 SMART
Int_alpha 400 449 1.07e1 SMART
Int_alpha 453 511 5.91e-7 SMART
Int_alpha 517 573 4.9e-13 SMART
Int_alpha 580 634 3.67e-3 SMART
low complexity region 850 856 N/A INTRINSIC
Pfam:Integrin_alpha 1131 1145 8.4e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120355
AA Change: R277G

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000113957
Gene: ENSMUSG00000030786
AA Change: R277G

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
Int_alpha 30 80 8.11e0 SMART
VWA 148 333 2.63e-49 SMART
Int_alpha 400 449 1.07e1 SMART
Int_alpha 453 511 5.91e-7 SMART
Int_alpha 517 573 4.9e-13 SMART
Int_alpha 580 634 3.67e-3 SMART
low complexity region 850 856 N/A INTRINSIC
low complexity region 1141 1150 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 100% (39/39)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130011E15Rik A G 19: 45,960,357 Y228H probably damaging Het
Alg3 T C 16: 20,605,986 T270A possibly damaging Het
Ambp G C 4: 63,150,359 H140Q probably benign Het
Arhgef10 T C 8: 14,928,786 C18R probably benign Het
Arhgef10l A G 4: 140,544,419 F548S probably damaging Het
Cdhr1 T C 14: 37,085,645 D346G probably damaging Het
Col18a1 T A 10: 77,113,484 probably benign Het
Col1a2 T A 6: 4,539,587 L1285Q unknown Het
Cspg5 T C 9: 110,246,784 L196P probably damaging Het
Dusp10 T G 1: 184,069,196 Y387D probably damaging Het
Epb41 A T 4: 131,935,829 D681E probably damaging Het
Eps8 A G 6: 137,512,257 V381A probably damaging Het
Fam129c T A 8: 71,605,671 V540D probably damaging Het
Fbxw16 A T 9: 109,436,742 S336R probably benign Het
Gsg1 C T 6: 135,237,420 V320I probably benign Het
Iglc3 T A 16: 19,065,508 probably benign Het
Klc4 A T 17: 46,631,843 N598K probably benign Het
Malsu1 A G 6: 49,075,251 Y135C probably damaging Het
Mapkbp1 T C 2: 120,015,802 I477T probably damaging Het
Mtss1 G T 15: 58,951,659 S286R probably damaging Het
Naip2 A C 13: 100,162,041 S496A probably benign Het
Npepps A T 11: 97,267,644 C98* probably null Het
Nphp3 A C 9: 104,041,954 Y1267S probably damaging Het
Npr3 A G 15: 11,883,392 V317A possibly damaging Het
Nsun6 A G 2: 15,048,977 I7T probably damaging Het
Olfr1342 A G 4: 118,689,531 V307A possibly damaging Het
Olfr1480 C T 19: 13,530,081 T180I probably damaging Het
Olfr632 A T 7: 103,937,859 T160S possibly damaging Het
Pcnx A G 12: 81,971,376 H1330R probably benign Het
Rad17 T C 13: 100,637,084 I201V probably benign Het
Slc26a4 G A 12: 31,549,951 T126M possibly damaging Het
Slitrk6 A T 14: 110,751,096 L393* probably null Het
Snx2 A G 18: 53,212,879 H378R probably damaging Het
Tex21 A G 12: 76,239,455 probably null Het
Trio A T 15: 27,919,288 probably benign Het
Vpreb2 T C 16: 17,980,956 I102T probably damaging Het
Zfp617 T G 8: 71,932,166 H113Q probably benign Het
Zgpat T A 2: 181,378,511 I237N probably damaging Het
Other mutations in Gm49368
AlleleSourceChrCoordTypePredicted EffectPPH Score
R7085:Gm49368 UTSW 7 128126857 missense unknown
R7475:Gm49368 UTSW 7 128107982 missense possibly damaging 0.60
R7578:Gm49368 UTSW 7 128112258 nonsense probably null
R7685:Gm49368 UTSW 7 128113242 missense probably damaging 1.00
R7757:Gm49368 UTSW 7 128112226 missense probably damaging 1.00
R7994:Gm49368 UTSW 7 128085646 missense possibly damaging 0.50
R8081:Gm49368 UTSW 7 128127108 missense unknown
R8145:Gm49368 UTSW 7 128113315 missense probably null 0.84
R8368:Gm49368 UTSW 7 128114749 missense probably benign
R8485:Gm49368 UTSW 7 128112439 missense probably damaging 1.00
R8542:Gm49368 UTSW 7 128080261 missense probably damaging 1.00
R8543:Gm49368 UTSW 7 128080261 missense probably damaging 1.00
R8545:Gm49368 UTSW 7 128080261 missense probably damaging 1.00
R8870:Gm49368 UTSW 7 128101513 missense probably benign
Z1177:Gm49368 UTSW 7 128113067 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCGATCCTGACTCTGTAG -3'
(R):5'- CATTATTGTGGCATAGATATGTGGC -3'

Sequencing Primer
(F):5'- GCCGGATGCTAACAATATCTCTG -3'
(R):5'- CATAGATATGTGGCAGCTGGGC -3'
Posted On2018-10-18