Incidental Mutation 'R6890:Fam129c'
ID537157
Institutional Source Beutler Lab
Gene Symbol Fam129c
Ensembl Gene ENSMUSG00000043243
Gene Namefamily with sequence similarity 129, member C
SynonymsBcnp1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6890 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location71597648-71607936 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 71605671 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 540 (V540D)
Ref Sequence ENSEMBL: ENSMUSP00000123432 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000125339] [ENSMUST00000126559] [ENSMUST00000127626] [ENSMUST00000143662]
Predicted Effect possibly damaging
Transcript: ENSMUST00000125339
AA Change: V47D

PolyPhen 2 Score 0.915 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000119708
Gene: ENSMUSG00000043243
AA Change: V47D

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
low complexity region 110 119 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126559
Predicted Effect probably benign
Transcript: ENSMUST00000127626
SMART Domains Protein: ENSMUSP00000122042
Gene: ENSMUSG00000031807

DomainStartEndE-ValueType
Pfam:Glucosamine_iso 18 214 7.2e-62 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000143662
AA Change: V540D

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000123432
Gene: ENSMUSG00000043243
AA Change: V540D

DomainStartEndE-ValueType
low complexity region 9 20 N/A INTRINSIC
PH 68 196 4.94e-4 SMART
low complexity region 218 230 N/A INTRINSIC
low complexity region 260 269 N/A INTRINSIC
low complexity region 437 448 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 100% (39/39)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130011E15Rik A G 19: 45,960,357 Y228H probably damaging Het
Alg3 T C 16: 20,605,986 T270A possibly damaging Het
Ambp G C 4: 63,150,359 H140Q probably benign Het
Arhgef10 T C 8: 14,928,786 C18R probably benign Het
Arhgef10l A G 4: 140,544,419 F548S probably damaging Het
Cdhr1 T C 14: 37,085,645 D346G probably damaging Het
Col18a1 T A 10: 77,113,484 probably benign Het
Col1a2 T A 6: 4,539,587 L1285Q unknown Het
Cspg5 T C 9: 110,246,784 L196P probably damaging Het
Dusp10 T G 1: 184,069,196 Y387D probably damaging Het
Epb41 A T 4: 131,935,829 D681E probably damaging Het
Eps8 A G 6: 137,512,257 V381A probably damaging Het
Fbxw16 A T 9: 109,436,742 S336R probably benign Het
Gm49368 A G 7: 128,081,729 R277G probably benign Het
Gsg1 C T 6: 135,237,420 V320I probably benign Het
Iglc3 T A 16: 19,065,508 probably benign Het
Klc4 A T 17: 46,631,843 N598K probably benign Het
Malsu1 A G 6: 49,075,251 Y135C probably damaging Het
Mapkbp1 T C 2: 120,015,802 I477T probably damaging Het
Mtss1 G T 15: 58,951,659 S286R probably damaging Het
Naip2 A C 13: 100,162,041 S496A probably benign Het
Npepps A T 11: 97,267,644 C98* probably null Het
Nphp3 A C 9: 104,041,954 Y1267S probably damaging Het
Npr3 A G 15: 11,883,392 V317A possibly damaging Het
Nsun6 A G 2: 15,048,977 I7T probably damaging Het
Olfr1342 A G 4: 118,689,531 V307A possibly damaging Het
Olfr1480 C T 19: 13,530,081 T180I probably damaging Het
Olfr632 A T 7: 103,937,859 T160S possibly damaging Het
Pcnx A G 12: 81,971,376 H1330R probably benign Het
Rad17 T C 13: 100,637,084 I201V probably benign Het
Slc26a4 G A 12: 31,549,951 T126M possibly damaging Het
Slitrk6 A T 14: 110,751,096 L393* probably null Het
Snx2 A G 18: 53,212,879 H378R probably damaging Het
Tex21 A G 12: 76,239,455 probably null Het
Trio A T 15: 27,919,288 probably benign Het
Vpreb2 T C 16: 17,980,956 I102T probably damaging Het
Zfp617 T G 8: 71,932,166 H113Q probably benign Het
Zgpat T A 2: 181,378,511 I237N probably damaging Het
Other mutations in Fam129c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00985:Fam129c APN 8 71604863 splice site probably benign
IGL01530:Fam129c APN 8 71603917 splice site probably benign
IGL01553:Fam129c APN 8 71602902 missense possibly damaging 0.86
IGL02313:Fam129c APN 8 71602860 missense possibly damaging 0.92
IGL02341:Fam129c APN 8 71603799 missense possibly damaging 0.60
IGL02541:Fam129c APN 8 71602782 missense probably benign 0.07
IGL02745:Fam129c APN 8 71605038 splice site probably null
R0006:Fam129c UTSW 8 71605044 splice site probably benign
R0391:Fam129c UTSW 8 71602499 splice site probably benign
R0594:Fam129c UTSW 8 71599135 missense probably benign 0.07
R1208:Fam129c UTSW 8 71600475 missense probably damaging 0.99
R1208:Fam129c UTSW 8 71600475 missense probably damaging 0.99
R1643:Fam129c UTSW 8 71600164 missense probably benign 0.34
R1848:Fam129c UTSW 8 71603769 missense possibly damaging 0.95
R1986:Fam129c UTSW 8 71603760 missense possibly damaging 0.63
R2319:Fam129c UTSW 8 71602764 missense probably benign 0.00
R4386:Fam129c UTSW 8 71607511 intron probably benign
R4564:Fam129c UTSW 8 71605060 intron probably benign
R4666:Fam129c UTSW 8 71603825 nonsense probably null
R6341:Fam129c UTSW 8 71600077 missense probably damaging 1.00
R6364:Fam129c UTSW 8 71599089 missense probably benign 0.08
R6888:Fam129c UTSW 8 71603739 missense probably benign
R7383:Fam129c UTSW 8 71603826 missense possibly damaging 0.86
R7441:Fam129c UTSW 8 71600164 missense probably benign 0.34
R7459:Fam129c UTSW 8 71605027 missense possibly damaging 0.75
R7527:Fam129c UTSW 8 71606698 missense probably damaging 0.99
R7873:Fam129c UTSW 8 71602248 missense probably damaging 1.00
R8698:Fam129c UTSW 8 71607515 missense unknown
Predicted Primers PCR Primer
(F):5'- CTGTGACACATGCTATGGCG -3'
(R):5'- TGAAAATCTCCTCCCAGCG -3'

Sequencing Primer
(F):5'- CATGCTATGGCGTGTGGG -3'
(R):5'- GAAAATCTCCTCCCAGCGTCTCC -3'
Posted On2018-10-18