Incidental Mutation 'R6890:Nphp3'
ID537159
Institutional Source Beutler Lab
Gene Symbol Nphp3
Ensembl Gene ENSMUSG00000032558
Gene Namenephronophthisis 3 (adolescent)
Synonyms3632410F03Rik, D330020E01Rik, pcy, nephrocystin 3
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6890 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location104002544-104043818 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 104041954 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Serine at position 1267 (Y1267S)
Ref Sequence ENSEMBL: ENSMUSP00000035167 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035166] [ENSMUST00000035167] [ENSMUST00000193439] [ENSMUST00000194183] [ENSMUST00000194774] [ENSMUST00000216593]
Predicted Effect probably benign
Transcript: ENSMUST00000035166
SMART Domains Protein: ENSMUSP00000035166
Gene: ENSMUSG00000032557

DomainStartEndE-ValueType
coiled coil region 1 30 N/A INTRINSIC
Pfam:ThiF 51 309 2.8e-48 PFAM
low complexity region 317 332 N/A INTRINSIC
low complexity region 343 353 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000035167
AA Change: Y1267S

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000035167
Gene: ENSMUSG00000032558
AA Change: Y1267S

DomainStartEndE-ValueType
low complexity region 46 69 N/A INTRINSIC
coiled coil region 107 203 N/A INTRINSIC
low complexity region 512 537 N/A INTRINSIC
low complexity region 613 627 N/A INTRINSIC
low complexity region 640 650 N/A INTRINSIC
TPR 938 971 3.16e1 SMART
TPR 980 1013 7.74e-2 SMART
TPR 1022 1055 3.24e1 SMART
low complexity region 1066 1080 N/A INTRINSIC
TPR 1088 1121 3.67e-3 SMART
TPR 1130 1163 1.3e-3 SMART
TPR 1172 1205 4.38e-1 SMART
TPR 1214 1247 8.69e-5 SMART
TPR 1256 1289 9.03e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000147249
SMART Domains Protein: ENSMUSP00000115381
Gene: ENSMUSG00000101152

DomainStartEndE-ValueType
Pfam:TPR_12 1 48 3e-14 PFAM
Pfam:TPR_12 12 75 2.1e-14 PFAM
Pfam:TPR_10 15 56 7.8e-13 PFAM
Pfam:TPR_1 16 49 4.4e-9 PFAM
Pfam:TPR_7 18 58 7e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193439
SMART Domains Protein: ENSMUSP00000141540
Gene: ENSMUSG00000032558

DomainStartEndE-ValueType
coiled coil region 75 109 N/A INTRINSIC
low complexity region 418 443 N/A INTRINSIC
low complexity region 519 532 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194183
SMART Domains Protein: ENSMUSP00000142049
Gene: ENSMUSG00000032558

DomainStartEndE-ValueType
Pfam:TPR_10 1 37 3.4e-5 PFAM
Pfam:TPR_12 1 71 1.8e-14 PFAM
Pfam:TPR_10 38 79 6.5e-8 PFAM
Pfam:TPR_1 39 72 6.8e-4 PFAM
Pfam:TPR_10 81 115 9e-3 PFAM
Pfam:TPR_7 83 118 1.6e-2 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000194774
AA Change: Y1147S
SMART Domains Protein: ENSMUSP00000141596
Gene: ENSMUSG00000032558
AA Change: Y1147S

DomainStartEndE-ValueType
coiled coil region 49 83 N/A INTRINSIC
Pfam:NACHT 400 559 2e-6 PFAM
TPR 818 851 3.16e1 SMART
TPR 860 893 7.74e-2 SMART
TPR 902 935 3.24e1 SMART
low complexity region 946 960 N/A INTRINSIC
TPR 968 1001 3.67e-3 SMART
TPR 1010 1043 1.3e-3 SMART
TPR 1052 1085 4.38e-1 SMART
TPR 1094 1127 8.69e-5 SMART
TPR 1136 1169 9.03e-3 SMART
Predicted Effect silent
Transcript: ENSMUST00000216593
Meta Mutation Damage Score 0.6037 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a coiled-coil (CC) domain, a tubulin-tyrosine ligase (TTL) domain, and a tetratrico peptide repeat (TPR) domain. The encoded protein interacts with nephrocystin, it is required for normal ciliary development, and it functions in renal tubular development. Mutations in this gene are associated with nephronophthisis type 3, and also with renal-hepatic-pancreatic dysplasia, and Meckel syndrome type 7. Naturally occurring read-through transcripts exist between this gene and the downstream ACAD11 (acyl-CoA dehydrogenase family, member 11) gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous hypomorphic mice display slowly progressing kidney cysts, enlarged kidneys, increased blood urea nitrogen, kidney inflammation and associated fibrosis, and premature death. Homozygous null mice display mid gestational lethality with partial penetrance of situs inversus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130011E15Rik A G 19: 45,960,357 Y228H probably damaging Het
Alg3 T C 16: 20,605,986 T270A possibly damaging Het
Ambp G C 4: 63,150,359 H140Q probably benign Het
Arhgef10 T C 8: 14,928,786 C18R probably benign Het
Arhgef10l A G 4: 140,544,419 F548S probably damaging Het
Cdhr1 T C 14: 37,085,645 D346G probably damaging Het
Col18a1 T A 10: 77,113,484 probably benign Het
Col1a2 T A 6: 4,539,587 L1285Q unknown Het
Cspg5 T C 9: 110,246,784 L196P probably damaging Het
Dusp10 T G 1: 184,069,196 Y387D probably damaging Het
Epb41 A T 4: 131,935,829 D681E probably damaging Het
Eps8 A G 6: 137,512,257 V381A probably damaging Het
Fam129c T A 8: 71,605,671 V540D probably damaging Het
Fbxw16 A T 9: 109,436,742 S336R probably benign Het
Gm49368 A G 7: 128,081,729 R277G probably benign Het
Gsg1 C T 6: 135,237,420 V320I probably benign Het
Iglc3 T A 16: 19,065,508 probably benign Het
Klc4 A T 17: 46,631,843 N598K probably benign Het
Malsu1 A G 6: 49,075,251 Y135C probably damaging Het
Mapkbp1 T C 2: 120,015,802 I477T probably damaging Het
Mtss1 G T 15: 58,951,659 S286R probably damaging Het
Naip2 A C 13: 100,162,041 S496A probably benign Het
Npepps A T 11: 97,267,644 C98* probably null Het
Npr3 A G 15: 11,883,392 V317A possibly damaging Het
Nsun6 A G 2: 15,048,977 I7T probably damaging Het
Olfr1342 A G 4: 118,689,531 V307A possibly damaging Het
Olfr1480 C T 19: 13,530,081 T180I probably damaging Het
Olfr632 A T 7: 103,937,859 T160S possibly damaging Het
Pcnx A G 12: 81,971,376 H1330R probably benign Het
Rad17 T C 13: 100,637,084 I201V probably benign Het
Slc26a4 G A 12: 31,549,951 T126M possibly damaging Het
Slitrk6 A T 14: 110,751,096 L393* probably null Het
Snx2 A G 18: 53,212,879 H378R probably damaging Het
Tex21 A G 12: 76,239,455 probably null Het
Trio A T 15: 27,919,288 probably benign Het
Vpreb2 T C 16: 17,980,956 I102T probably damaging Het
Zfp617 T G 8: 71,932,166 H113Q probably benign Het
Zgpat T A 2: 181,378,511 I237N probably damaging Het
Other mutations in Nphp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01707:Nphp3 APN 9 104018158 missense possibly damaging 0.75
IGL02329:Nphp3 APN 9 104025968 missense probably benign 0.19
lithograph UTSW 9 104041990 missense probably damaging 1.00
F5770:Nphp3 UTSW 9 104035894 critical splice donor site probably null
FR4548:Nphp3 UTSW 9 104025939 small deletion probably benign
FR4589:Nphp3 UTSW 9 104025939 small deletion probably benign
R0112:Nphp3 UTSW 9 104037348 missense possibly damaging 0.80
R0555:Nphp3 UTSW 9 104023434 missense probably damaging 1.00
R0632:Nphp3 UTSW 9 104018274 missense probably damaging 1.00
R0674:Nphp3 UTSW 9 104036282 critical splice donor site probably null
R0743:Nphp3 UTSW 9 104022768 small deletion probably benign
R0853:Nphp3 UTSW 9 104031933 missense probably benign 0.03
R0920:Nphp3 UTSW 9 104031907 missense probably benign 0.00
R1420:Nphp3 UTSW 9 104035893 critical splice donor site probably null
R1464:Nphp3 UTSW 9 104031879 splice site probably benign
R1476:Nphp3 UTSW 9 104025927 missense possibly damaging 0.81
R1585:Nphp3 UTSW 9 104009214 missense probably damaging 1.00
R1608:Nphp3 UTSW 9 104035840 missense probably benign 0.30
R1688:Nphp3 UTSW 9 104003124 missense probably damaging 1.00
R1691:Nphp3 UTSW 9 104002811 missense probably benign
R1807:Nphp3 UTSW 9 104020741 missense probably benign 0.01
R1857:Nphp3 UTSW 9 104021294 missense possibly damaging 0.87
R1962:Nphp3 UTSW 9 104021338 missense probably benign 0.00
R2127:Nphp3 UTSW 9 104008243 missense probably damaging 0.98
R2138:Nphp3 UTSW 9 104025903 missense possibly damaging 0.89
R2233:Nphp3 UTSW 9 104037376 missense probably benign 0.02
R2234:Nphp3 UTSW 9 104037376 missense probably benign 0.02
R3861:Nphp3 UTSW 9 104039326 unclassified probably benign
R3928:Nphp3 UTSW 9 104011730 missense probably damaging 0.99
R3961:Nphp3 UTSW 9 104003042 nonsense probably null
R4182:Nphp3 UTSW 9 104038464 missense probably benign 0.06
R4294:Nphp3 UTSW 9 104022717 missense probably damaging 1.00
R4387:Nphp3 UTSW 9 104030020 missense possibly damaging 0.94
R4625:Nphp3 UTSW 9 104036159 missense possibly damaging 0.66
R4628:Nphp3 UTSW 9 104003058 missense probably damaging 0.99
R4696:Nphp3 UTSW 9 104022732 missense probably benign 0.01
R4865:Nphp3 UTSW 9 104031970 missense probably benign
R4886:Nphp3 UTSW 9 104002994 missense probably damaging 1.00
R4973:Nphp3 UTSW 9 104031999 missense probably benign
R5445:Nphp3 UTSW 9 104004723 missense probably damaging 1.00
R5451:Nphp3 UTSW 9 104042022 missense probably benign
R5520:Nphp3 UTSW 9 104024673 missense probably benign 0.30
R5641:Nphp3 UTSW 9 104036153 missense probably damaging 1.00
R5847:Nphp3 UTSW 9 104003037 missense probably damaging 1.00
R5928:Nphp3 UTSW 9 104035797 missense probably benign 0.01
R5931:Nphp3 UTSW 9 104020746 missense probably damaging 1.00
R6161:Nphp3 UTSW 9 104031906 missense probably benign 0.11
R6298:Nphp3 UTSW 9 104015441 missense probably damaging 1.00
R7009:Nphp3 UTSW 9 104016116 missense probably null 0.00
R7065:Nphp3 UTSW 9 104041990 missense probably damaging 1.00
R7146:Nphp3 UTSW 9 104004837 nonsense probably null
R7198:Nphp3 UTSW 9 104004775 missense probably damaging 1.00
R7360:Nphp3 UTSW 9 104016078 critical splice acceptor site probably null
R7369:Nphp3 UTSW 9 104018250 missense probably damaging 0.99
R7554:Nphp3 UTSW 9 104042071 missense probably damaging 0.98
R7591:Nphp3 UTSW 9 104018278 critical splice donor site probably null
R7665:Nphp3 UTSW 9 104005393 splice site probably null
R7672:Nphp3 UTSW 9 104031960 missense probably benign
R7675:Nphp3 UTSW 9 104016088 missense probably benign
R8039:Nphp3 UTSW 9 104031963 missense probably benign
R8145:Nphp3 UTSW 9 104035851 missense probably benign 0.16
R8211:Nphp3 UTSW 9 104031897 missense possibly damaging 0.80
R8882:Nphp3 UTSW 9 104005594 missense possibly damaging 0.77
V7583:Nphp3 UTSW 9 104035894 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GCAGGTGATAACAACACTTAGC -3'
(R):5'- TTGACGGTTAGCTTTGCCC -3'

Sequencing Primer
(F):5'- TTTCTTAAATACAGGGGAACACCAGG -3'
(R):5'- CCTTGGGGAAGAAAAACGTTAG -3'
Posted On2018-10-18