Incidental Mutation 'R6890:Fbxw16'
ID537160
Institutional Source Beutler Lab
Gene Symbol Fbxw16
Ensembl Gene ENSMUSG00000074062
Gene NameF-box and WD-40 domain protein 16
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.053) question?
Stock #R6890 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location109432316-109449140 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 109436742 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 336 (S336R)
Ref Sequence ENSEMBL: ENSMUSP00000082051 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084984]
Predicted Effect probably benign
Transcript: ENSMUST00000084984
AA Change: S336R

PolyPhen 2 Score 0.141 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000082051
Gene: ENSMUSG00000074062
AA Change: S336R

DomainStartEndE-ValueType
FBOX 5 45 2.72e-6 SMART
SCOP:d1e1aa_ 128 249 3e-5 SMART
Blast:WD40 137 176 1e-7 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 100% (39/39)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130011E15Rik A G 19: 45,960,357 Y228H probably damaging Het
Alg3 T C 16: 20,605,986 T270A possibly damaging Het
Ambp G C 4: 63,150,359 H140Q probably benign Het
Arhgef10 T C 8: 14,928,786 C18R probably benign Het
Arhgef10l A G 4: 140,544,419 F548S probably damaging Het
Cdhr1 T C 14: 37,085,645 D346G probably damaging Het
Col18a1 T A 10: 77,113,484 probably benign Het
Col1a2 T A 6: 4,539,587 L1285Q unknown Het
Cspg5 T C 9: 110,246,784 L196P probably damaging Het
Dusp10 T G 1: 184,069,196 Y387D probably damaging Het
Epb41 A T 4: 131,935,829 D681E probably damaging Het
Eps8 A G 6: 137,512,257 V381A probably damaging Het
Fam129c T A 8: 71,605,671 V540D probably damaging Het
Gm49368 A G 7: 128,081,729 R277G probably benign Het
Gsg1 C T 6: 135,237,420 V320I probably benign Het
Iglc3 T A 16: 19,065,508 probably benign Het
Klc4 A T 17: 46,631,843 N598K probably benign Het
Malsu1 A G 6: 49,075,251 Y135C probably damaging Het
Mapkbp1 T C 2: 120,015,802 I477T probably damaging Het
Mtss1 G T 15: 58,951,659 S286R probably damaging Het
Naip2 A C 13: 100,162,041 S496A probably benign Het
Npepps A T 11: 97,267,644 C98* probably null Het
Nphp3 A C 9: 104,041,954 Y1267S probably damaging Het
Npr3 A G 15: 11,883,392 V317A possibly damaging Het
Nsun6 A G 2: 15,048,977 I7T probably damaging Het
Olfr1342 A G 4: 118,689,531 V307A possibly damaging Het
Olfr1480 C T 19: 13,530,081 T180I probably damaging Het
Olfr632 A T 7: 103,937,859 T160S possibly damaging Het
Pcnx A G 12: 81,971,376 H1330R probably benign Het
Rad17 T C 13: 100,637,084 I201V probably benign Het
Slc26a4 G A 12: 31,549,951 T126M possibly damaging Het
Slitrk6 A T 14: 110,751,096 L393* probably null Het
Snx2 A G 18: 53,212,879 H378R probably damaging Het
Tex21 A G 12: 76,239,455 probably null Het
Trio A T 15: 27,919,288 probably benign Het
Vpreb2 T C 16: 17,980,956 I102T probably damaging Het
Zfp617 T G 8: 71,932,166 H113Q probably benign Het
Zgpat T A 2: 181,378,511 I237N probably damaging Het
Other mutations in Fbxw16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02139:Fbxw16 APN 9 109436686 missense probably benign 0.34
IGL02801:Fbxw16 APN 9 109441076 missense possibly damaging 0.73
milky_way UTSW 9 109441250 missense probably damaging 1.00
R0041:Fbxw16 UTSW 9 109448164 missense probably damaging 1.00
R0245:Fbxw16 UTSW 9 109436168 missense possibly damaging 0.93
R0389:Fbxw16 UTSW 9 109432482 missense probably benign 0.03
R0652:Fbxw16 UTSW 9 109436168 missense possibly damaging 0.93
R1693:Fbxw16 UTSW 9 109436259 missense possibly damaging 0.74
R1772:Fbxw16 UTSW 9 109439582 missense possibly damaging 0.91
R1965:Fbxw16 UTSW 9 109441221 missense probably damaging 1.00
R2190:Fbxw16 UTSW 9 109436671 missense probably damaging 1.00
R2334:Fbxw16 UTSW 9 109438361 missense probably benign 0.16
R3800:Fbxw16 UTSW 9 109436597 missense probably damaging 0.99
R3976:Fbxw16 UTSW 9 109439629 missense probably benign 0.42
R4298:Fbxw16 UTSW 9 109446557 missense probably benign 0.00
R4914:Fbxw16 UTSW 9 109438177 missense probably benign 0.01
R4948:Fbxw16 UTSW 9 109438347 missense probably damaging 1.00
R4995:Fbxw16 UTSW 9 109441250 missense probably damaging 1.00
R5057:Fbxw16 UTSW 9 109441164 missense probably damaging 1.00
R5077:Fbxw16 UTSW 9 109441049 critical splice donor site probably null
R5111:Fbxw16 UTSW 9 109436728 missense probably benign 0.11
R5294:Fbxw16 UTSW 9 109436644 missense probably benign 0.34
R5901:Fbxw16 UTSW 9 109441217 missense probably benign 0.06
R6295:Fbxw16 UTSW 9 109448769 intron probably benign
R6303:Fbxw16 UTSW 9 109449101 missense probably benign 0.00
R6664:Fbxw16 UTSW 9 109438258 missense probably benign 0.27
R6670:Fbxw16 UTSW 9 109438212 missense probably damaging 1.00
R7056:Fbxw16 UTSW 9 109436284 missense possibly damaging 0.50
R7073:Fbxw16 UTSW 9 109441055 missense probably damaging 1.00
R7344:Fbxw16 UTSW 9 109449035 missense probably benign 0.00
R7396:Fbxw16 UTSW 9 109449023 missense probably damaging 1.00
R7464:Fbxw16 UTSW 9 109439551 missense possibly damaging 0.50
R7568:Fbxw16 UTSW 9 109439589 missense possibly damaging 0.49
R7735:Fbxw16 UTSW 9 109441067 missense probably damaging 1.00
R7808:Fbxw16 UTSW 9 109448154 missense probably damaging 0.96
R7998:Fbxw16 UTSW 9 109436698 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGCACACCCCAACAGTATG -3'
(R):5'- TGAACTTGACAGACCAATGGAC -3'

Sequencing Primer
(F):5'- TTTAACCACTGAGGGGAAAACATTCC -3'
(R):5'- CAGACCAATGGACTGTTTTCATTGTC -3'
Posted On2018-10-18