Incidental Mutation 'R6890:Cspg5'
ID537161
Institutional Source Beutler Lab
Gene Symbol Cspg5
Ensembl Gene ENSMUSG00000032482
Gene Namechondroitin sulfate proteoglycan 5
SynonymsCALEB, neuroglycan C, NGC
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.224) question?
Stock #R6890 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location110243783-110262576 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 110246784 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 196 (L196P)
Ref Sequence ENSEMBL: ENSMUSP00000035058 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035058] [ENSMUST00000196060] [ENSMUST00000197850] [ENSMUST00000199736]
Predicted Effect probably damaging
Transcript: ENSMUST00000035058
AA Change: L196P

PolyPhen 2 Score 0.984 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000035058
Gene: ENSMUSG00000032482
AA Change: L196P

DomainStartEndE-ValueType
low complexity region 4 31 N/A INTRINSIC
Pfam:Chon_Sulph_att 33 278 2.5e-123 PFAM
low complexity region 290 302 N/A INTRINSIC
EGF 373 413 1.99e1 SMART
transmembrane domain 421 443 N/A INTRINSIC
Pfam:Neural_ProG_Cyt 447 565 5.8e-73 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196060
AA Change: L196P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000143164
Gene: ENSMUSG00000032482
AA Change: L196P

DomainStartEndE-ValueType
Pfam:Chon_Sulph_att 31 278 1e-126 PFAM
low complexity region 290 302 N/A INTRINSIC
EGF 373 413 1.99e1 SMART
transmembrane domain 421 443 N/A INTRINSIC
Pfam:Neural_ProG_Cyt 447 487 8.9e-26 PFAM
Pfam:Neural_ProG_Cyt 486 539 1.3e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197850
AA Change: L196P

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000143005
Gene: ENSMUSG00000032482
AA Change: L196P

DomainStartEndE-ValueType
Pfam:Chon_Sulph_att 31 278 1.1e-126 PFAM
low complexity region 290 302 N/A INTRINSIC
EGF 373 413 1.99e1 SMART
transmembrane domain 421 443 N/A INTRINSIC
Pfam:Neural_ProG_Cyt 447 520 1.5e-45 PFAM
low complexity region 524 539 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199736
AA Change: L115P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000142845
Gene: ENSMUSG00000032482
AA Change: L115P

DomainStartEndE-ValueType
Pfam:Chon_Sulph_att 1 197 1.6e-99 PFAM
low complexity region 209 221 N/A INTRINSIC
EGF 292 332 9.5e-2 SMART
transmembrane domain 340 362 N/A INTRINSIC
Pfam:Neural_ProG_Cyt 366 406 1.2e-22 PFAM
Pfam:Neural_ProG_Cyt 405 458 1.7e-28 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: This gene encodes a chondroitin sulfate proteoglycan. The encoded protein has been termed a 'part-time' proteoglycan, as chondroitin sulfate chains appear to be attached to the protein in the developing but not the adult cerebellum and retina. It is thought that this protein plays roles in dendrite branching and synapse formation. [provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous null mice display decreased spontaneous postsynaptic currents, increased paired-pulse ratios, and reduced long term depression during early postnatal developmental stages. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130011E15Rik A G 19: 45,960,357 Y228H probably damaging Het
Alg3 T C 16: 20,605,986 T270A possibly damaging Het
Ambp G C 4: 63,150,359 H140Q probably benign Het
Arhgef10 T C 8: 14,928,786 C18R probably benign Het
Arhgef10l A G 4: 140,544,419 F548S probably damaging Het
Cdhr1 T C 14: 37,085,645 D346G probably damaging Het
Col18a1 T A 10: 77,113,484 probably benign Het
Col1a2 T A 6: 4,539,587 L1285Q unknown Het
Dusp10 T G 1: 184,069,196 Y387D probably damaging Het
Epb41 A T 4: 131,935,829 D681E probably damaging Het
Eps8 A G 6: 137,512,257 V381A probably damaging Het
Fam129c T A 8: 71,605,671 V540D probably damaging Het
Fbxw16 A T 9: 109,436,742 S336R probably benign Het
Gm49368 A G 7: 128,081,729 R277G probably benign Het
Gsg1 C T 6: 135,237,420 V320I probably benign Het
Iglc3 T A 16: 19,065,508 probably benign Het
Klc4 A T 17: 46,631,843 N598K probably benign Het
Malsu1 A G 6: 49,075,251 Y135C probably damaging Het
Mapkbp1 T C 2: 120,015,802 I477T probably damaging Het
Mtss1 G T 15: 58,951,659 S286R probably damaging Het
Naip2 A C 13: 100,162,041 S496A probably benign Het
Npepps A T 11: 97,267,644 C98* probably null Het
Nphp3 A C 9: 104,041,954 Y1267S probably damaging Het
Npr3 A G 15: 11,883,392 V317A possibly damaging Het
Nsun6 A G 2: 15,048,977 I7T probably damaging Het
Olfr1342 A G 4: 118,689,531 V307A possibly damaging Het
Olfr1480 C T 19: 13,530,081 T180I probably damaging Het
Olfr632 A T 7: 103,937,859 T160S possibly damaging Het
Pcnx A G 12: 81,971,376 H1330R probably benign Het
Rad17 T C 13: 100,637,084 I201V probably benign Het
Slc26a4 G A 12: 31,549,951 T126M possibly damaging Het
Slitrk6 A T 14: 110,751,096 L393* probably null Het
Snx2 A G 18: 53,212,879 H378R probably damaging Het
Tex21 A G 12: 76,239,455 probably null Het
Trio A T 15: 27,919,288 probably benign Het
Vpreb2 T C 16: 17,980,956 I102T probably damaging Het
Zfp617 T G 8: 71,932,166 H113Q probably benign Het
Zgpat T A 2: 181,378,511 I237N probably damaging Het
Other mutations in Cspg5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01304:Cspg5 APN 9 110256168 missense probably damaging 1.00
IGL01516:Cspg5 APN 9 110246693 missense probably benign 0.37
IGL01800:Cspg5 APN 9 110251150 splice site probably benign
IGL01927:Cspg5 APN 9 110262084 missense probably damaging 0.99
IGL02164:Cspg5 APN 9 110251036 missense probably damaging 0.98
IGL02338:Cspg5 APN 9 110256267 missense probably benign 0.04
IGL02421:Cspg5 APN 9 110247392 critical splice donor site probably benign
R0106:Cspg5 UTSW 9 110246532 missense probably damaging 0.96
R0540:Cspg5 UTSW 9 110247392 critical splice donor site probably null
R0905:Cspg5 UTSW 9 110246526 missense probably damaging 0.99
R1772:Cspg5 UTSW 9 110262138 missense probably damaging 1.00
R1959:Cspg5 UTSW 9 110251026 missense probably damaging 1.00
R4356:Cspg5 UTSW 9 110256177 missense probably damaging 1.00
R4771:Cspg5 UTSW 9 110251127 missense probably damaging 1.00
R5345:Cspg5 UTSW 9 110246630 missense probably benign 0.03
R5441:Cspg5 UTSW 9 110246643 missense probably benign
R5474:Cspg5 UTSW 9 110251008 missense probably damaging 1.00
R5946:Cspg5 UTSW 9 110251083 missense probably damaging 0.99
R7028:Cspg5 UTSW 9 110246891 missense possibly damaging 0.85
R7286:Cspg5 UTSW 9 110246955 missense probably damaging 1.00
R7697:Cspg5 UTSW 9 110256226 missense probably damaging 0.99
R7858:Cspg5 UTSW 9 110251066 missense probably damaging 1.00
X0020:Cspg5 UTSW 9 110247173 missense probably damaging 0.96
Z1176:Cspg5 UTSW 9 110251050 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGAGGCCCTTGGGTCATCTAC -3'
(R):5'- TGTGGTGGGGTAGAAATCAGACTC -3'

Sequencing Primer
(F):5'- GCCCTTGGGTCATCTACAATGC -3'
(R):5'- CTCATCAAAAGGGGTGAAGTCATC -3'
Posted On2018-10-18