Incidental Mutation 'R6890:Slc26a4'
ID537164
Institutional Source Beutler Lab
Gene Symbol Slc26a4
Ensembl Gene ENSMUSG00000020651
Gene Namesolute carrier family 26, member 4
SynonymsPds, pendrin
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6890 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location31519827-31559969 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 31549951 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 126 (T126M)
Ref Sequence ENSEMBL: ENSMUSP00000001253 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001253]
Predicted Effect possibly damaging
Transcript: ENSMUST00000001253
AA Change: T126M

PolyPhen 2 Score 0.786 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000001253
Gene: ENSMUSG00000020651
AA Change: T126M

DomainStartEndE-ValueType
low complexity region 33 47 N/A INTRINSIC
Pfam:Sulfate_transp 84 485 1e-105 PFAM
low complexity region 492 507 N/A INTRINSIC
Pfam:STAS 536 725 1.4e-42 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mutations in this gene are associated with Pendred syndrome, the most common form of syndromic deafness, an autosomal-recessive disease. It is highly homologous to the SLC26A3 gene; they have similar genomic structures and this gene is located 3' of the SLC26A3 gene. The encoded protein has homology to sulfate transporters. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants are completely deaf with vestibular dysfunction. Mutants show endolymphatic dilatation, degeneration of sensory cells and malformations of otoconia and otoconial membranes. They display unsteady gait and circling and head bobbing. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130011E15Rik A G 19: 45,960,357 Y228H probably damaging Het
Alg3 T C 16: 20,605,986 T270A possibly damaging Het
Ambp G C 4: 63,150,359 H140Q probably benign Het
Arhgef10 T C 8: 14,928,786 C18R probably benign Het
Arhgef10l A G 4: 140,544,419 F548S probably damaging Het
Cdhr1 T C 14: 37,085,645 D346G probably damaging Het
Col18a1 T A 10: 77,113,484 probably benign Het
Col1a2 T A 6: 4,539,587 L1285Q unknown Het
Cspg5 T C 9: 110,246,784 L196P probably damaging Het
Dusp10 T G 1: 184,069,196 Y387D probably damaging Het
Epb41 A T 4: 131,935,829 D681E probably damaging Het
Eps8 A G 6: 137,512,257 V381A probably damaging Het
Fam129c T A 8: 71,605,671 V540D probably damaging Het
Fbxw16 A T 9: 109,436,742 S336R probably benign Het
Gm49368 A G 7: 128,081,729 R277G probably benign Het
Gsg1 C T 6: 135,237,420 V320I probably benign Het
Iglc3 T A 16: 19,065,508 probably benign Het
Klc4 A T 17: 46,631,843 N598K probably benign Het
Malsu1 A G 6: 49,075,251 Y135C probably damaging Het
Mapkbp1 T C 2: 120,015,802 I477T probably damaging Het
Mtss1 G T 15: 58,951,659 S286R probably damaging Het
Naip2 A C 13: 100,162,041 S496A probably benign Het
Npepps A T 11: 97,267,644 C98* probably null Het
Nphp3 A C 9: 104,041,954 Y1267S probably damaging Het
Npr3 A G 15: 11,883,392 V317A possibly damaging Het
Nsun6 A G 2: 15,048,977 I7T probably damaging Het
Olfr1342 A G 4: 118,689,531 V307A possibly damaging Het
Olfr1480 C T 19: 13,530,081 T180I probably damaging Het
Olfr632 A T 7: 103,937,859 T160S possibly damaging Het
Pcnx A G 12: 81,971,376 H1330R probably benign Het
Rad17 T C 13: 100,637,084 I201V probably benign Het
Slitrk6 A T 14: 110,751,096 L393* probably null Het
Snx2 A G 18: 53,212,879 H378R probably damaging Het
Tex21 A G 12: 76,239,455 probably null Het
Trio A T 15: 27,919,288 probably benign Het
Vpreb2 T C 16: 17,980,956 I102T probably damaging Het
Zfp617 T G 8: 71,932,166 H113Q probably benign Het
Zgpat T A 2: 181,378,511 I237N probably damaging Het
Other mutations in Slc26a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01754:Slc26a4 APN 12 31528854 splice site probably benign
IGL01763:Slc26a4 APN 12 31528854 splice site probably benign
IGL01778:Slc26a4 APN 12 31528854 splice site probably benign
IGL01779:Slc26a4 APN 12 31528854 splice site probably benign
IGL01872:Slc26a4 APN 12 31539203 missense probably benign 0.22
IGL02016:Slc26a4 APN 12 31535667 missense probably damaging 0.99
IGL02184:Slc26a4 APN 12 31549949 missense probably damaging 1.00
IGL02267:Slc26a4 APN 12 31528854 splice site probably benign
IGL02270:Slc26a4 APN 12 31528854 splice site probably benign
IGL02271:Slc26a4 APN 12 31528854 splice site probably benign
IGL02347:Slc26a4 APN 12 31528854 splice site probably benign
IGL02543:Slc26a4 APN 12 31528689 missense possibly damaging 0.75
IGL02803:Slc26a4 APN 12 31522527 critical splice acceptor site probably null
IGL02885:Slc26a4 APN 12 31525476 missense probably benign 0.00
IGL02974:Slc26a4 APN 12 31529554 missense probably damaging 1.00
IGL03037:Slc26a4 APN 12 31531687 splice site probably benign
cul-de-sac UTSW 12 31525568 nonsense probably null
discobolus UTSW 12 31540533 nonsense probably null
R0152:Slc26a4 UTSW 12 31529498 missense probably damaging 1.00
R0677:Slc26a4 UTSW 12 31549911 critical splice donor site probably null
R0961:Slc26a4 UTSW 12 31535619 missense probably benign
R1025:Slc26a4 UTSW 12 31528737 missense probably damaging 1.00
R1301:Slc26a4 UTSW 12 31525568 nonsense probably null
R1729:Slc26a4 UTSW 12 31544494 missense possibly damaging 0.95
R2321:Slc26a4 UTSW 12 31540544 missense probably damaging 1.00
R3967:Slc26a4 UTSW 12 31528687 missense probably damaging 1.00
R3970:Slc26a4 UTSW 12 31528687 missense probably damaging 1.00
R4007:Slc26a4 UTSW 12 31540533 nonsense probably null
R4370:Slc26a4 UTSW 12 31529476 missense probably benign 0.01
R4647:Slc26a4 UTSW 12 31540526 missense possibly damaging 0.90
R4648:Slc26a4 UTSW 12 31540526 missense possibly damaging 0.90
R5816:Slc26a4 UTSW 12 31528685 missense probably damaging 1.00
R5932:Slc26a4 UTSW 12 31535249 critical splice donor site probably null
R6675:Slc26a4 UTSW 12 31540513 missense possibly damaging 0.89
R6732:Slc26a4 UTSW 12 31526600 critical splice donor site probably null
R7231:Slc26a4 UTSW 12 31547946 missense probably damaging 1.00
R7286:Slc26a4 UTSW 12 31529528 nonsense probably null
R7790:Slc26a4 UTSW 12 31544483 missense probably damaging 1.00
R7812:Slc26a4 UTSW 12 31544450 missense probably damaging 1.00
R8002:Slc26a4 UTSW 12 31547970 missense probably benign 0.00
R8362:Slc26a4 UTSW 12 31544507 missense probably benign 0.00
R8531:Slc26a4 UTSW 12 31549912 critical splice donor site probably null
X0022:Slc26a4 UTSW 12 31535687 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCACAGTCCCATATGTAGC -3'
(R):5'- ACTCAGGACAGGCTGATATTTTG -3'

Sequencing Primer
(F):5'- GTAGCTAACATTGCCAGTTAATAGAG -3'
(R):5'- CAGGACAGGCTGATATTTTGAATCC -3'
Posted On2018-10-18