Incidental Mutation 'R6890:Cdhr1'
ID537168
Institutional Source Beutler Lab
Gene Symbol Cdhr1
Ensembl Gene ENSMUSG00000021803
Gene Namecadherin-related family member 1
SynonymsPcdh21, Prcad
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock #R6890 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location37077857-37098347 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 37085645 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 346 (D346G)
Ref Sequence ENSEMBL: ENSMUSP00000022337 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022337]
Predicted Effect probably damaging
Transcript: ENSMUST00000022337
AA Change: D346G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022337
Gene: ENSMUSG00000021803
AA Change: D346G

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CA 57 133 9.4e-7 SMART
CA 157 245 9.44e-21 SMART
CA 269 352 2.06e-12 SMART
CA 383 471 2.68e-11 SMART
CA 495 575 5.26e-19 SMART
CA 594 685 1.64e-6 SMART
transmembrane domain 703 725 N/A INTRINSIC
low complexity region 734 745 N/A INTRINSIC
low complexity region 789 799 N/A INTRINSIC
low complexity region 817 829 N/A INTRINSIC
Meta Mutation Damage Score 0.9453 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the cadherin superfamily of calcium-dependent cell adhesion molecules. The encoded protein is a photoreceptor-specific cadherin that plays a role in outer segment disc morphogenesis. Mutations in this gene are associated with inherited retinal dystrophies. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit progressive degeneration of retinal photoreceptor cells and a slight reduction in light responses. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130011E15Rik A G 19: 45,960,357 Y228H probably damaging Het
Alg3 T C 16: 20,605,986 T270A possibly damaging Het
Ambp G C 4: 63,150,359 H140Q probably benign Het
Arhgef10 T C 8: 14,928,786 C18R probably benign Het
Arhgef10l A G 4: 140,544,419 F548S probably damaging Het
Col18a1 T A 10: 77,113,484 probably benign Het
Col1a2 T A 6: 4,539,587 L1285Q unknown Het
Cspg5 T C 9: 110,246,784 L196P probably damaging Het
Dusp10 T G 1: 184,069,196 Y387D probably damaging Het
Epb41 A T 4: 131,935,829 D681E probably damaging Het
Eps8 A G 6: 137,512,257 V381A probably damaging Het
Fam129c T A 8: 71,605,671 V540D probably damaging Het
Fbxw16 A T 9: 109,436,742 S336R probably benign Het
Gm49368 A G 7: 128,081,729 R277G probably benign Het
Gsg1 C T 6: 135,237,420 V320I probably benign Het
Iglc3 T A 16: 19,065,508 probably benign Het
Klc4 A T 17: 46,631,843 N598K probably benign Het
Malsu1 A G 6: 49,075,251 Y135C probably damaging Het
Mapkbp1 T C 2: 120,015,802 I477T probably damaging Het
Mtss1 G T 15: 58,951,659 S286R probably damaging Het
Naip2 A C 13: 100,162,041 S496A probably benign Het
Npepps A T 11: 97,267,644 C98* probably null Het
Nphp3 A C 9: 104,041,954 Y1267S probably damaging Het
Npr3 A G 15: 11,883,392 V317A possibly damaging Het
Nsun6 A G 2: 15,048,977 I7T probably damaging Het
Olfr1342 A G 4: 118,689,531 V307A possibly damaging Het
Olfr1480 C T 19: 13,530,081 T180I probably damaging Het
Olfr632 A T 7: 103,937,859 T160S possibly damaging Het
Pcnx A G 12: 81,971,376 H1330R probably benign Het
Rad17 T C 13: 100,637,084 I201V probably benign Het
Slc26a4 G A 12: 31,549,951 T126M possibly damaging Het
Slitrk6 A T 14: 110,751,096 L393* probably null Het
Snx2 A G 18: 53,212,879 H378R probably damaging Het
Tex21 A G 12: 76,239,455 probably null Het
Trio A T 15: 27,919,288 probably benign Het
Vpreb2 T C 16: 17,980,956 I102T probably damaging Het
Zfp617 T G 8: 71,932,166 H113Q probably benign Het
Zgpat T A 2: 181,378,511 I237N probably damaging Het
Other mutations in Cdhr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00673:Cdhr1 APN 14 37085528 missense probably benign 0.06
IGL01820:Cdhr1 APN 14 37085579 missense probably benign 0.11
IGL02469:Cdhr1 APN 14 37085600 missense possibly damaging 0.68
IGL03373:Cdhr1 APN 14 37096300 missense possibly damaging 0.89
IGL03055:Cdhr1 UTSW 14 37095097 missense probably benign 0.07
PIT4494001:Cdhr1 UTSW 14 37082856 missense probably benign 0.07
R0110:Cdhr1 UTSW 14 37080676 missense probably damaging 0.99
R0219:Cdhr1 UTSW 14 37079601 missense possibly damaging 0.82
R0265:Cdhr1 UTSW 14 37081376 missense probably benign 0.02
R0450:Cdhr1 UTSW 14 37080676 missense probably damaging 0.99
R0510:Cdhr1 UTSW 14 37080676 missense probably damaging 0.99
R0522:Cdhr1 UTSW 14 37094000 critical splice donor site probably null
R0788:Cdhr1 UTSW 14 37087375 critical splice donor site probably null
R0880:Cdhr1 UTSW 14 37080634 missense possibly damaging 0.53
R1209:Cdhr1 UTSW 14 37082942 splice site probably null
R1253:Cdhr1 UTSW 14 37079625 missense probably benign
R1604:Cdhr1 UTSW 14 37095093 missense probably benign 0.29
R1968:Cdhr1 UTSW 14 37079725 missense probably benign 0.00
R2064:Cdhr1 UTSW 14 37095105 missense probably benign 0.10
R2248:Cdhr1 UTSW 14 37081377 missense probably benign
R3843:Cdhr1 UTSW 14 37084927 missense probably benign 0.03
R4178:Cdhr1 UTSW 14 37082939 splice site probably null
R4205:Cdhr1 UTSW 14 37080504 missense probably benign 0.00
R4681:Cdhr1 UTSW 14 37096237 missense probably benign 0.01
R5039:Cdhr1 UTSW 14 37079643 missense probably benign 0.02
R5088:Cdhr1 UTSW 14 37089465 missense probably benign 0.08
R5383:Cdhr1 UTSW 14 37089007 missense possibly damaging 0.94
R5507:Cdhr1 UTSW 14 37082845 missense probably damaging 0.98
R5933:Cdhr1 UTSW 14 37089462 missense probably benign 0.01
R6074:Cdhr1 UTSW 14 37079643 missense probably benign 0.02
R6291:Cdhr1 UTSW 14 37089465 missense probably benign 0.31
R6449:Cdhr1 UTSW 14 37090597 missense probably benign 0.35
R6891:Cdhr1 UTSW 14 37097377 splice site probably null
R7653:Cdhr1 UTSW 14 37082201 missense probably benign 0.27
R7740:Cdhr1 UTSW 14 37089380 missense probably damaging 0.98
R7805:Cdhr1 UTSW 14 37081545 missense probably benign 0.00
R8081:Cdhr1 UTSW 14 37094010 missense probably benign 0.01
R8147:Cdhr1 UTSW 14 37079652 missense probably benign 0.02
R8164:Cdhr1 UTSW 14 37079542 missense probably damaging 1.00
R8283:Cdhr1 UTSW 14 37082780 missense probably benign 0.00
R8343:Cdhr1 UTSW 14 37091978 missense probably benign 0.00
R8848:Cdhr1 UTSW 14 37080574 missense probably benign 0.21
R8938:Cdhr1 UTSW 14 37087448 missense probably benign 0.17
X0062:Cdhr1 UTSW 14 37079779 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGACCCAGTCACTTTCAAGG -3'
(R):5'- ACACTCAGTCTTGACTTTGTAGC -3'

Sequencing Primer
(F):5'- CCAGTCACTTTCAAGGGCATG -3'
(R):5'- GGATTCCAAGGTCATTGACATAGCTG -3'
Posted On2018-10-18