Incidental Mutation 'R6890:Slitrk6'
ID537169
Institutional Source Beutler Lab
Gene Symbol Slitrk6
Ensembl Gene ENSMUSG00000045871
Gene NameSLIT and NTRK-like family, member 6
Synonyms4832410J21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.162) question?
Stock #R6890 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location110748580-110755149 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 110751096 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 393 (L393*)
Ref Sequence ENSEMBL: ENSMUSP00000077492 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078386]
Predicted Effect probably null
Transcript: ENSMUST00000078386
AA Change: L393*
SMART Domains Protein: ENSMUSP00000077492
Gene: ENSMUSG00000045871
AA Change: L393*

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Blast:LRRNT 30 68 4e-15 BLAST
LRR 87 110 1.71e1 SMART
LRR 111 134 3.07e-1 SMART
LRR 135 158 4.44e0 SMART
LRR_TYP 159 182 2.09e-3 SMART
LRR 185 206 6.23e1 SMART
LRRCT 218 268 5.61e-5 SMART
low complexity region 287 301 N/A INTRINSIC
Blast:LRRNT 327 364 2e-17 BLAST
LRR 388 408 2.68e1 SMART
LRR_TYP 409 432 3.63e-3 SMART
LRR_TYP 433 456 6.23e-2 SMART
LRR_TYP 457 480 3.69e-4 SMART
low complexity region 501 513 N/A INTRINSIC
LRRCT 516 566 1.53e-6 SMART
transmembrane domain 610 632 N/A INTRINSIC
low complexity region 634 642 N/A INTRINSIC
Meta Mutation Damage Score 0.9716 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SLITRK protein family. Members of this family are integral membrane proteins that are characterized by two N-terminal leucine-rich repeat (LRR) domains and a C-terminal region that shares homology with trk neurotrophin receptors. This protein functions as a regulator of neurite outgrowth required for normal hearing and vision. Mutations in this gene are a cause of myopia and deafness. [provided by RefSeq, Dec 2014]
PHENOTYPE: Homozygous deficient mice show pronounced reduction in cochlear innervation. Innervation to the posterior crista is variably impaired and a there is a loss of neurons in the spiral and vestibular ganglia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130011E15Rik A G 19: 45,960,357 Y228H probably damaging Het
Alg3 T C 16: 20,605,986 T270A possibly damaging Het
Ambp G C 4: 63,150,359 H140Q probably benign Het
Arhgef10 T C 8: 14,928,786 C18R probably benign Het
Arhgef10l A G 4: 140,544,419 F548S probably damaging Het
Cdhr1 T C 14: 37,085,645 D346G probably damaging Het
Col18a1 T A 10: 77,113,484 probably benign Het
Col1a2 T A 6: 4,539,587 L1285Q unknown Het
Cspg5 T C 9: 110,246,784 L196P probably damaging Het
Dusp10 T G 1: 184,069,196 Y387D probably damaging Het
Epb41 A T 4: 131,935,829 D681E probably damaging Het
Eps8 A G 6: 137,512,257 V381A probably damaging Het
Fam129c T A 8: 71,605,671 V540D probably damaging Het
Fbxw16 A T 9: 109,436,742 S336R probably benign Het
Gm49368 A G 7: 128,081,729 R277G probably benign Het
Gsg1 C T 6: 135,237,420 V320I probably benign Het
Iglc3 T A 16: 19,065,508 probably benign Het
Klc4 A T 17: 46,631,843 N598K probably benign Het
Malsu1 A G 6: 49,075,251 Y135C probably damaging Het
Mapkbp1 T C 2: 120,015,802 I477T probably damaging Het
Mtss1 G T 15: 58,951,659 S286R probably damaging Het
Naip2 A C 13: 100,162,041 S496A probably benign Het
Npepps A T 11: 97,267,644 C98* probably null Het
Nphp3 A C 9: 104,041,954 Y1267S probably damaging Het
Npr3 A G 15: 11,883,392 V317A possibly damaging Het
Nsun6 A G 2: 15,048,977 I7T probably damaging Het
Olfr1342 A G 4: 118,689,531 V307A possibly damaging Het
Olfr1480 C T 19: 13,530,081 T180I probably damaging Het
Olfr632 A T 7: 103,937,859 T160S possibly damaging Het
Pcnx A G 12: 81,971,376 H1330R probably benign Het
Rad17 T C 13: 100,637,084 I201V probably benign Het
Slc26a4 G A 12: 31,549,951 T126M possibly damaging Het
Snx2 A G 18: 53,212,879 H378R probably damaging Het
Tex21 A G 12: 76,239,455 probably null Het
Trio A T 15: 27,919,288 probably benign Het
Vpreb2 T C 16: 17,980,956 I102T probably damaging Het
Zfp617 T G 8: 71,932,166 H113Q probably benign Het
Zgpat T A 2: 181,378,511 I237N probably damaging Het
Other mutations in Slitrk6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00517:Slitrk6 APN 14 110751115 missense probably benign 0.35
IGL01131:Slitrk6 APN 14 110751576 missense probably damaging 1.00
IGL01294:Slitrk6 APN 14 110750074 missense probably benign
IGL01295:Slitrk6 APN 14 110751436 missense possibly damaging 0.50
IGL01762:Slitrk6 APN 14 110751624 missense probably damaging 1.00
IGL02165:Slitrk6 APN 14 110751817 missense probably benign 0.41
IGL02546:Slitrk6 APN 14 110749794 missense probably benign 0.18
IGL03103:Slitrk6 APN 14 110749941 missense probably benign
PIT1430001:Slitrk6 UTSW 14 110750427 missense possibly damaging 0.93
PIT4480001:Slitrk6 UTSW 14 110749825 frame shift probably null
R0035:Slitrk6 UTSW 14 110749932 missense probably damaging 1.00
R0066:Slitrk6 UTSW 14 110749932 missense probably damaging 1.00
R0067:Slitrk6 UTSW 14 110749932 missense probably damaging 1.00
R0069:Slitrk6 UTSW 14 110749932 missense probably damaging 1.00
R0107:Slitrk6 UTSW 14 110751963 missense possibly damaging 0.69
R0157:Slitrk6 UTSW 14 110749932 missense probably damaging 1.00
R0422:Slitrk6 UTSW 14 110749932 missense probably damaging 1.00
R0422:Slitrk6 UTSW 14 110752293 start gained probably benign
R0454:Slitrk6 UTSW 14 110749932 missense probably damaging 1.00
R0505:Slitrk6 UTSW 14 110749932 missense probably damaging 1.00
R0633:Slitrk6 UTSW 14 110751885 missense probably damaging 1.00
R0711:Slitrk6 UTSW 14 110749819 missense probably damaging 1.00
R0843:Slitrk6 UTSW 14 110750098 missense probably benign
R1298:Slitrk6 UTSW 14 110751865 missense possibly damaging 0.94
R1693:Slitrk6 UTSW 14 110750928 missense probably damaging 1.00
R1756:Slitrk6 UTSW 14 110750552 missense probably benign
R1998:Slitrk6 UTSW 14 110751823 missense probably damaging 0.99
R2049:Slitrk6 UTSW 14 110750794 missense probably benign 0.00
R2140:Slitrk6 UTSW 14 110750794 missense probably benign 0.00
R2142:Slitrk6 UTSW 14 110750794 missense probably benign 0.00
R2314:Slitrk6 UTSW 14 110751955 missense probably damaging 1.00
R2566:Slitrk6 UTSW 14 110750272 missense probably benign 0.00
R4231:Slitrk6 UTSW 14 110751388 missense probably benign 0.02
R4236:Slitrk6 UTSW 14 110750148 missense probably benign 0.07
R4247:Slitrk6 UTSW 14 110750739 missense probably damaging 1.00
R4576:Slitrk6 UTSW 14 110750170 missense probably benign 0.05
R4856:Slitrk6 UTSW 14 110751883 missense probably damaging 1.00
R4858:Slitrk6 UTSW 14 110751883 missense probably damaging 1.00
R4859:Slitrk6 UTSW 14 110751883 missense probably damaging 1.00
R4860:Slitrk6 UTSW 14 110751883 missense probably damaging 1.00
R4860:Slitrk6 UTSW 14 110751883 missense probably damaging 1.00
R4886:Slitrk6 UTSW 14 110751883 missense probably damaging 1.00
R4931:Slitrk6 UTSW 14 110750379 missense probably damaging 1.00
R5255:Slitrk6 UTSW 14 110749753 makesense probably null
R5281:Slitrk6 UTSW 14 110750373 missense probably damaging 1.00
R5450:Slitrk6 UTSW 14 110750097 missense probably benign
R5579:Slitrk6 UTSW 14 110751217 missense possibly damaging 0.82
R5689:Slitrk6 UTSW 14 110752126 missense probably benign
R5935:Slitrk6 UTSW 14 110749873 missense probably benign 0.00
R6016:Slitrk6 UTSW 14 110750526 missense probably benign 0.00
R6312:Slitrk6 UTSW 14 110750247 missense probably benign 0.00
R6952:Slitrk6 UTSW 14 110750542 missense probably benign
R7378:Slitrk6 UTSW 14 110749863 missense probably damaging 1.00
R8354:Slitrk6 UTSW 14 110752046 missense probably damaging 1.00
R8401:Slitrk6 UTSW 14 110752021 missense possibly damaging 0.67
R8454:Slitrk6 UTSW 14 110752046 missense probably damaging 1.00
R8807:Slitrk6 UTSW 14 110750691 missense possibly damaging 0.77
R8814:Slitrk6 UTSW 14 110749938 missense probably benign
R8826:Slitrk6 UTSW 14 110751369 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGTGCCGGTAAAACTTGAAGG -3'
(R):5'- GCAATTGCAAAGTTCTCTCCC -3'

Sequencing Primer
(F):5'- TGAAGGTCCCTGGTAATATTTCC -3'
(R):5'- GCAAAGTTCTCTCCCCTTCGG -3'
Posted On2018-10-18