Incidental Mutation 'R6890:Vpreb2'
ID537173
Institutional Source Beutler Lab
Gene Symbol Vpreb2
Ensembl Gene ENSMUSG00000059280
Gene Namepre-B lymphocyte gene 2
SynonymsVpreb-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.146) question?
Stock #R6890 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location17980428-17981273 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 17980956 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 102 (I102T)
Ref Sequence ENSEMBL: ENSMUSP00000074835 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075371]
Predicted Effect probably damaging
Transcript: ENSMUST00000075371
AA Change: I102T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074835
Gene: ENSMUSG00000059280
AA Change: I102T

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
IGv 36 117 1.31e-25 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 100% (39/39)
MGI Phenotype PHENOTYPE: Mice homozygous for null mutations at both Vpreb1 and Vpreb2 show impaired B-cell development. Fewer small pre-BII and immature B- cells are in bone marrow and numbers of B-cells in spleen and peritoneum are reduced. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130011E15Rik A G 19: 45,960,357 Y228H probably damaging Het
Alg3 T C 16: 20,605,986 T270A possibly damaging Het
Ambp G C 4: 63,150,359 H140Q probably benign Het
Arhgef10 T C 8: 14,928,786 C18R probably benign Het
Arhgef10l A G 4: 140,544,419 F548S probably damaging Het
Cdhr1 T C 14: 37,085,645 D346G probably damaging Het
Col18a1 T A 10: 77,113,484 probably benign Het
Col1a2 T A 6: 4,539,587 L1285Q unknown Het
Cspg5 T C 9: 110,246,784 L196P probably damaging Het
Dusp10 T G 1: 184,069,196 Y387D probably damaging Het
Epb41 A T 4: 131,935,829 D681E probably damaging Het
Eps8 A G 6: 137,512,257 V381A probably damaging Het
Fam129c T A 8: 71,605,671 V540D probably damaging Het
Fbxw16 A T 9: 109,436,742 S336R probably benign Het
Gm49368 A G 7: 128,081,729 R277G probably benign Het
Gsg1 C T 6: 135,237,420 V320I probably benign Het
Iglc3 T A 16: 19,065,508 probably benign Het
Klc4 A T 17: 46,631,843 N598K probably benign Het
Malsu1 A G 6: 49,075,251 Y135C probably damaging Het
Mapkbp1 T C 2: 120,015,802 I477T probably damaging Het
Mtss1 G T 15: 58,951,659 S286R probably damaging Het
Naip2 A C 13: 100,162,041 S496A probably benign Het
Npepps A T 11: 97,267,644 C98* probably null Het
Nphp3 A C 9: 104,041,954 Y1267S probably damaging Het
Npr3 A G 15: 11,883,392 V317A possibly damaging Het
Nsun6 A G 2: 15,048,977 I7T probably damaging Het
Olfr1342 A G 4: 118,689,531 V307A possibly damaging Het
Olfr1480 C T 19: 13,530,081 T180I probably damaging Het
Olfr632 A T 7: 103,937,859 T160S possibly damaging Het
Pcnx A G 12: 81,971,376 H1330R probably benign Het
Rad17 T C 13: 100,637,084 I201V probably benign Het
Slc26a4 G A 12: 31,549,951 T126M possibly damaging Het
Slitrk6 A T 14: 110,751,096 L393* probably null Het
Snx2 A G 18: 53,212,879 H378R probably damaging Het
Tex21 A G 12: 76,239,455 probably null Het
Trio A T 15: 27,919,288 probably benign Het
Zfp617 T G 8: 71,932,166 H113Q probably benign Het
Zgpat T A 2: 181,378,511 I237N probably damaging Het
Other mutations in Vpreb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02609:Vpreb2 APN 16 17980694 splice site probably benign
R0045:Vpreb2 UTSW 16 17980767 missense probably damaging 1.00
R2157:Vpreb2 UTSW 16 17981070 nonsense probably null
R6395:Vpreb2 UTSW 16 17980907 missense probably damaging 0.99
R6996:Vpreb2 UTSW 16 17980577 missense probably benign
R8437:Vpreb2 UTSW 16 17980889 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCCTGTACCCTGAGCAAC -3'
(R):5'- CATCTTCTAGGCTCTGCAAAGC -3'

Sequencing Primer
(F):5'- CGACCATAACATTGGCATTTACAG -3'
(R):5'- TTCCCATACCAGACTAGCCGAG -3'
Posted On2018-10-18