Incidental Mutation 'R6890:Klc4'
ID537176
Institutional Source Beutler Lab
Gene Symbol Klc4
Ensembl Gene ENSMUSG00000003546
Gene Namekinesin light chain 4
SynonymsKnsl8, 1200014P03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.591) question?
Stock #R6890 (G1)
Quality Score224.009
Status Validated
Chromosome17
Chromosomal Location46630631-46645144 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 46631843 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 598 (N598K)
Ref Sequence ENSEMBL: ENSMUSP00000003642 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003642] [ENSMUST00000044442]
Predicted Effect probably benign
Transcript: ENSMUST00000003642
AA Change: N598K

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000003642
Gene: ENSMUSG00000003546
AA Change: N598K

DomainStartEndE-ValueType
coiled coil region 90 155 N/A INTRINSIC
low complexity region 194 204 N/A INTRINSIC
Pfam:TPR_10 210 251 9.4e-9 PFAM
TPR 253 286 3.32e-1 SMART
TPR 295 328 7.16e-6 SMART
TPR 337 370 4.21e-3 SMART
TPR 379 412 9.03e-3 SMART
low complexity region 429 443 N/A INTRINSIC
TPR 464 497 9.99e1 SMART
low complexity region 609 619 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000044442
SMART Domains Protein: ENSMUSP00000043703
Gene: ENSMUSG00000023972

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IGc2 36 100 1.48e-6 SMART
IGc2 133 199 8.12e-13 SMART
IGc2 229 300 5.01e-4 SMART
IGc2 326 390 1.96e-6 SMART
IG 410 491 6.02e-7 SMART
IGc2 507 569 1.19e-10 SMART
IGc2 596 663 2.6e-11 SMART
transmembrane domain 696 718 N/A INTRINSIC
TyrKc 788 1053 4.34e-115 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 100% (39/39)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130011E15Rik A G 19: 45,960,357 Y228H probably damaging Het
Alg3 T C 16: 20,605,986 T270A possibly damaging Het
Ambp G C 4: 63,150,359 H140Q probably benign Het
Arhgef10 T C 8: 14,928,786 C18R probably benign Het
Arhgef10l A G 4: 140,544,419 F548S probably damaging Het
Cdhr1 T C 14: 37,085,645 D346G probably damaging Het
Col18a1 T A 10: 77,113,484 probably benign Het
Col1a2 T A 6: 4,539,587 L1285Q unknown Het
Cspg5 T C 9: 110,246,784 L196P probably damaging Het
Dusp10 T G 1: 184,069,196 Y387D probably damaging Het
Epb41 A T 4: 131,935,829 D681E probably damaging Het
Eps8 A G 6: 137,512,257 V381A probably damaging Het
Fam129c T A 8: 71,605,671 V540D probably damaging Het
Fbxw16 A T 9: 109,436,742 S336R probably benign Het
Gm49368 A G 7: 128,081,729 R277G probably benign Het
Gsg1 C T 6: 135,237,420 V320I probably benign Het
Iglc3 T A 16: 19,065,508 probably benign Het
Malsu1 A G 6: 49,075,251 Y135C probably damaging Het
Mapkbp1 T C 2: 120,015,802 I477T probably damaging Het
Mtss1 G T 15: 58,951,659 S286R probably damaging Het
Naip2 A C 13: 100,162,041 S496A probably benign Het
Npepps A T 11: 97,267,644 C98* probably null Het
Nphp3 A C 9: 104,041,954 Y1267S probably damaging Het
Npr3 A G 15: 11,883,392 V317A possibly damaging Het
Nsun6 A G 2: 15,048,977 I7T probably damaging Het
Olfr1342 A G 4: 118,689,531 V307A possibly damaging Het
Olfr1480 C T 19: 13,530,081 T180I probably damaging Het
Olfr632 A T 7: 103,937,859 T160S possibly damaging Het
Pcnx A G 12: 81,971,376 H1330R probably benign Het
Rad17 T C 13: 100,637,084 I201V probably benign Het
Slc26a4 G A 12: 31,549,951 T126M possibly damaging Het
Slitrk6 A T 14: 110,751,096 L393* probably null Het
Snx2 A G 18: 53,212,879 H378R probably damaging Het
Tex21 A G 12: 76,239,455 probably null Het
Trio A T 15: 27,919,288 probably benign Het
Vpreb2 T C 16: 17,980,956 I102T probably damaging Het
Zfp617 T G 8: 71,932,166 H113Q probably benign Het
Zgpat T A 2: 181,378,511 I237N probably damaging Het
Other mutations in Klc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Klc4 APN 17 46635435 missense probably damaging 1.00
IGL01929:Klc4 APN 17 46644247 critical splice donor site probably null
IGL02550:Klc4 APN 17 46636910 splice site probably null
IGL03395:Klc4 APN 17 46632863 missense probably damaging 1.00
R0033:Klc4 UTSW 17 46635433 missense probably damaging 1.00
R1653:Klc4 UTSW 17 46631859 missense possibly damaging 0.91
R1681:Klc4 UTSW 17 46636770 missense probably damaging 0.99
R1944:Klc4 UTSW 17 46636627 missense probably damaging 1.00
R4981:Klc4 UTSW 17 46644361 missense probably benign 0.03
R5417:Klc4 UTSW 17 46632031 critical splice donor site probably null
R5577:Klc4 UTSW 17 46635429 missense probably damaging 1.00
R5742:Klc4 UTSW 17 46642271 missense probably damaging 1.00
R6224:Klc4 UTSW 17 46640062 missense possibly damaging 0.71
R6245:Klc4 UTSW 17 46636679 missense probably damaging 1.00
R6516:Klc4 UTSW 17 46642255 missense probably damaging 1.00
R6925:Klc4 UTSW 17 46636229 missense possibly damaging 0.69
R7466:Klc4 UTSW 17 46639910 missense probably benign 0.22
R7585:Klc4 UTSW 17 46631884 missense probably benign 0.01
R8273:Klc4 UTSW 17 46642154 missense possibly damaging 0.92
R8510:Klc4 UTSW 17 46644304 missense possibly damaging 0.93
R8723:Klc4 UTSW 17 46640700 missense probably benign 0.38
X0025:Klc4 UTSW 17 46640675 missense probably benign 0.12
Z1177:Klc4 UTSW 17 46635409 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TTCTGACTGAATCCTTTAGCCAG -3'
(R):5'- TCCAGGTACATGACAAGTGACAAG -3'

Sequencing Primer
(F):5'- ACCAGGCTGGCTTTAAATGC -3'
(R):5'- GGGGTAACTATGACAAAGCAGGTC -3'
Posted On2018-10-18