Mutagenetix > Incidental Mutations

Incidental Mutation 'R6891:Mrps9'

537180

Institutional Source

Beutler Lab

Gene Symbol

Mrps9

Ensembl Gene

ENSMUSG00000060679

Gene Name

mitochondrial ribosomal protein S9

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.930) question?

Stock #

R6891 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

42851233-42905683 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 42905413 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Isoleucine at position 364 (L364I)

Ref Sequence

ENSEMBL: ENSMUSP00000056855 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000057208]

AlphaFold

Q9D7N3

Predicted Effect

probably damaging
Transcript: ENSMUST00000057208
AA Change: L364I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000056855
Gene: ENSMUSG00000060679
AA Change: L364I

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
low complexity region	194	207	N/A	INTRINSIC
Pfam:Ribosomal_S9	268	390	7.3e-39	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000201108

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.0%

Validation Efficiency

97% (72/74)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4833423E24Rik	C	A	2: 85,488,805	M384I	possibly damaging	Het
4833423E24Rik	T	G	2: 85,488,813	T382P	probably damaging	Het
Actl11	C	T	9: 107,929,147	A223V	probably benign	Het
Agbl5	G	T	5: 30,895,178	R61L	probably damaging	Het
Agmat	A	T	4: 141,755,881	T209S	probably benign	Het
Ankrd34a	G	A	3: 96,598,019	V180I	probably benign	Het
Anks1	C	T	17: 28,057,424	T1047M	probably damaging	Het
Arhgap21	T	A	2: 20,850,331	I1407F	probably damaging	Het
Armc1	C	A	3: 19,135,041	C183F	probably damaging	Het
Atg13	A	G	2: 91,685,791	M196T	probably benign	Het
AU040320	G	T	4: 126,846,438	S864I	possibly damaging	Het
Btn2a2	T	C	13: 23,482,844	D197G	probably benign	Het
Carmil1	A	G	13: 24,141,723	I208T	probably benign	Het
Cbs	T	A	17: 31,622,457	R263S	probably damaging	Het
Ccdc7a	C	A	8: 129,026,638	R204L	probably damaging	Het
Cdhr1	A	T	14: 37,097,377		probably null	Het
Cers4	G	A	8: 4,523,731	R378Q	probably damaging	Het
Chst1	T	G	2: 92,613,743	L187V	probably benign	Het
Clec4e	A	T	6: 123,283,606	N164K	probably damaging	Het
Cln3	T	A	7: 126,582,803	D29V	possibly damaging	Het
Crybg2	A	G	4: 134,081,837	S187G	probably benign	Het
Ddx1	A	T	12: 13,236,095	N285K	probably benign	Het
Dmxl2	A	G	9: 54,480,380	I58T	probably damaging	Het
Dock4	A	G	12: 40,779,136	Y1007C	probably damaging	Het
Eral1	C	T	11: 78,075,733	V234I	possibly damaging	Het
Fam161b	A	G	12: 84,354,780	F400S	probably damaging	Het
Fmnl3	T	C	15: 99,325,873	D314G	probably damaging	Het
Foxred2	A	T	15: 77,955,709	L127Q	probably damaging	Het
Gjd2	G	A	2: 114,013,094	A14V	possibly damaging	Het
Gm3106	C	A	5: 94,218,119	P32Q	probably damaging	Het
Gon4l	A	G	3: 88,858,866		probably null	Het
Gpr151	T	A	18: 42,578,920	D231V	probably benign	Het
Gzf1	A	T	2: 148,684,769	K387*	probably null	Het
Hfm1	T	A	5: 106,917,374	K146N	possibly damaging	Het
Hgf	G	A	5: 16,604,922		probably null	Het
Isoc2b	A	G	7: 4,851,488	S15P	probably damaging	Het
Itga5	A	G	15: 103,357,543	S126P	probably damaging	Het
Kat6b	A	G	14: 21,669,036	D1152G	probably benign	Het
Kcna4	C	T	2: 107,296,307	S462F	probably damaging	Het
Kif24	A	T	4: 41,394,168	C902S	probably benign	Het
Lama2	A	T	10: 27,328,072	C523*	probably null	Het
Lama2	G	C	10: 27,328,082	S520*	probably null	Het
Ltf	T	C	9: 111,025,113	V332A	probably benign	Het
Mapkap1	T	C	2: 34,563,141	F349L	probably damaging	Het
Mdm1	A	G	10: 118,148,032	N188D	probably benign	Het
Mfn1	T	C	3: 32,577,103	S730P	possibly damaging	Het
Mrgprd	T	A	7: 145,322,350	D319E	probably benign	Het
Myo1h	C	T	5: 114,349,612	R626C	probably damaging	Het
Nme3	T	C	17: 24,896,855	S61P	probably benign	Het
Olfr123	A	G	17: 37,795,504	Q20R	probably benign	Het
Olfr670	A	G	7: 104,959,985	I249T	probably damaging	Het
Pald1	A	G	10: 61,348,532		probably null	Het
Papola	A	T	12: 105,809,691		probably benign	Het
Peg10	GAT	GATCAT	6: 4,756,449		probably benign	Het
Plch1	T	C	3: 63,698,083	T1458A	probably benign	Het
Polr3e	A	G	7: 120,944,650	Q659R	probably damaging	Het
Shoc2	T	C	19: 53,988,117	V146A	probably benign	Het
Slc15a1	T	C	14: 121,476,030	T362A	probably benign	Het
Smpd3	A	G	8: 106,264,668	Y418H	probably damaging	Het
Sorcs1	A	T	19: 50,225,119	C723*	probably null	Het
Supt7l	T	A	5: 31,523,021	N16Y	probably damaging	Het
Syngr2	T	C	11: 117,812,673	V105A	probably damaging	Het
Thrb	T	A	14: 17,981,899	V8E	probably benign	Het
Tlx1	A	T	19: 45,151,318	I135F	probably damaging	Het
Tnfaip3	A	G	10: 19,011,669	I36T	probably damaging	Het
Troap	A	G	15: 99,082,688	Y583C	possibly damaging	Het
Usp17lb	T	C	7: 104,841,100	K207E	probably benign	Het
Vmn2r10	C	T	5: 109,001,979	V400M	probably damaging	Het
Wdr49	A	T	3: 75,333,283		probably null	Het
Wdr64	G	T	1: 175,706,068	W90L	probably damaging	Het
Yme1l1	A	G	2: 23,195,389	E662G	probably damaging	Het
Zfp334	C	T	2: 165,382,724	V68I	probably benign	Het

Other mutations in Mrps9

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00897:Mrps9	APN	1	42905459	missense	probably damaging	1.00
IGL01134:Mrps9	APN	1	42903397	missense	probably damaging	0.97
IGL01557:Mrps9	APN	1	42851350	missense	probably benign
IGL02541:Mrps9	APN	1	42862654	splice site	probably null
PIT4402001:Mrps9	UTSW	1	42896098	missense	probably benign	0.10
R0598:Mrps9	UTSW	1	42905417	missense	probably damaging	1.00
R1718:Mrps9	UTSW	1	42903399	missense	probably damaging	1.00
R4195:Mrps9	UTSW	1	42901094	intron	probably benign
R4196:Mrps9	UTSW	1	42901094	intron	probably benign
R4695:Mrps9	UTSW	1	42862515	missense	possibly damaging	0.59
R4840:Mrps9	UTSW	1	42898415	intron	probably benign
R5033:Mrps9	UTSW	1	42895331	splice site	probably null
R5489:Mrps9	UTSW	1	42898433	splice site	probably benign
R5876:Mrps9	UTSW	1	42895378	missense	probably damaging	0.99
R7015:Mrps9	UTSW	1	42898546	missense	probably benign	0.04
R7940:Mrps9	UTSW	1	42862648	missense	probably damaging	0.98
R8679:Mrps9	UTSW	1	42879755	missense	probably damaging	0.99
R9117:Mrps9	UTSW	1	42903377	missense	probably benign	0.22
Z1177:Mrps9	UTSW	1	42899458	missense	probably benign	0.09

Predicted Primers

PCR Primer
(F):5'- AAAAGACGCATAAACCGTTGCTG -3'
(R):5'- GTAAACTCAAGACGATGTGTACAC -3'

Sequencing Primer
(F):5'- CATAAACCGTTGCTGTCAGTTG -3'
(R):5'- CAAGACGATGTGTACACGCTGC -3'

Posted On

2018-10-18