Incidental Mutation 'R6891:Mrps9'
ID 537180
Institutional Source Beutler Lab
Gene Symbol Mrps9
Ensembl Gene ENSMUSG00000060679
Gene Name mitochondrial ribosomal protein S9
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.930) question?
Stock # R6891 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 42851233-42905683 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 42905413 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Isoleucine at position 364 (L364I)
Ref Sequence ENSEMBL: ENSMUSP00000056855 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057208]
AlphaFold Q9D7N3
Predicted Effect probably damaging
Transcript: ENSMUST00000057208
AA Change: L364I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000056855
Gene: ENSMUSG00000060679
AA Change: L364I

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
low complexity region 194 207 N/A INTRINSIC
Pfam:Ribosomal_S9 268 390 7.3e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000201108
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 97% (72/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833423E24Rik C A 2: 85,488,805 M384I possibly damaging Het
4833423E24Rik T G 2: 85,488,813 T382P probably damaging Het
Actl11 C T 9: 107,929,147 A223V probably benign Het
Agbl5 G T 5: 30,895,178 R61L probably damaging Het
Agmat A T 4: 141,755,881 T209S probably benign Het
Ankrd34a G A 3: 96,598,019 V180I probably benign Het
Anks1 C T 17: 28,057,424 T1047M probably damaging Het
Arhgap21 T A 2: 20,850,331 I1407F probably damaging Het
Armc1 C A 3: 19,135,041 C183F probably damaging Het
Atg13 A G 2: 91,685,791 M196T probably benign Het
AU040320 G T 4: 126,846,438 S864I possibly damaging Het
Btn2a2 T C 13: 23,482,844 D197G probably benign Het
Carmil1 A G 13: 24,141,723 I208T probably benign Het
Cbs T A 17: 31,622,457 R263S probably damaging Het
Ccdc7a C A 8: 129,026,638 R204L probably damaging Het
Cdhr1 A T 14: 37,097,377 probably null Het
Cers4 G A 8: 4,523,731 R378Q probably damaging Het
Chst1 T G 2: 92,613,743 L187V probably benign Het
Clec4e A T 6: 123,283,606 N164K probably damaging Het
Cln3 T A 7: 126,582,803 D29V possibly damaging Het
Crybg2 A G 4: 134,081,837 S187G probably benign Het
Ddx1 A T 12: 13,236,095 N285K probably benign Het
Dmxl2 A G 9: 54,480,380 I58T probably damaging Het
Dock4 A G 12: 40,779,136 Y1007C probably damaging Het
Eral1 C T 11: 78,075,733 V234I possibly damaging Het
Fam161b A G 12: 84,354,780 F400S probably damaging Het
Fmnl3 T C 15: 99,325,873 D314G probably damaging Het
Foxred2 A T 15: 77,955,709 L127Q probably damaging Het
Gjd2 G A 2: 114,013,094 A14V possibly damaging Het
Gm3106 C A 5: 94,218,119 P32Q probably damaging Het
Gon4l A G 3: 88,858,866 probably null Het
Gpr151 T A 18: 42,578,920 D231V probably benign Het
Gzf1 A T 2: 148,684,769 K387* probably null Het
Hfm1 T A 5: 106,917,374 K146N possibly damaging Het
Hgf G A 5: 16,604,922 probably null Het
Isoc2b A G 7: 4,851,488 S15P probably damaging Het
Itga5 A G 15: 103,357,543 S126P probably damaging Het
Kat6b A G 14: 21,669,036 D1152G probably benign Het
Kcna4 C T 2: 107,296,307 S462F probably damaging Het
Kif24 A T 4: 41,394,168 C902S probably benign Het
Lama2 A T 10: 27,328,072 C523* probably null Het
Lama2 G C 10: 27,328,082 S520* probably null Het
Ltf T C 9: 111,025,113 V332A probably benign Het
Mapkap1 T C 2: 34,563,141 F349L probably damaging Het
Mdm1 A G 10: 118,148,032 N188D probably benign Het
Mfn1 T C 3: 32,577,103 S730P possibly damaging Het
Mrgprd T A 7: 145,322,350 D319E probably benign Het
Myo1h C T 5: 114,349,612 R626C probably damaging Het
Nme3 T C 17: 24,896,855 S61P probably benign Het
Olfr123 A G 17: 37,795,504 Q20R probably benign Het
Olfr670 A G 7: 104,959,985 I249T probably damaging Het
Pald1 A G 10: 61,348,532 probably null Het
Papola A T 12: 105,809,691 probably benign Het
Peg10 GAT GATCAT 6: 4,756,449 probably benign Het
Plch1 T C 3: 63,698,083 T1458A probably benign Het
Polr3e A G 7: 120,944,650 Q659R probably damaging Het
Shoc2 T C 19: 53,988,117 V146A probably benign Het
Slc15a1 T C 14: 121,476,030 T362A probably benign Het
Smpd3 A G 8: 106,264,668 Y418H probably damaging Het
Sorcs1 A T 19: 50,225,119 C723* probably null Het
Supt7l T A 5: 31,523,021 N16Y probably damaging Het
Syngr2 T C 11: 117,812,673 V105A probably damaging Het
Thrb T A 14: 17,981,899 V8E probably benign Het
Tlx1 A T 19: 45,151,318 I135F probably damaging Het
Tnfaip3 A G 10: 19,011,669 I36T probably damaging Het
Troap A G 15: 99,082,688 Y583C possibly damaging Het
Usp17lb T C 7: 104,841,100 K207E probably benign Het
Vmn2r10 C T 5: 109,001,979 V400M probably damaging Het
Wdr49 A T 3: 75,333,283 probably null Het
Wdr64 G T 1: 175,706,068 W90L probably damaging Het
Yme1l1 A G 2: 23,195,389 E662G probably damaging Het
Zfp334 C T 2: 165,382,724 V68I probably benign Het
Other mutations in Mrps9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Mrps9 APN 1 42905459 missense probably damaging 1.00
IGL01134:Mrps9 APN 1 42903397 missense probably damaging 0.97
IGL01557:Mrps9 APN 1 42851350 missense probably benign
IGL02541:Mrps9 APN 1 42862654 splice site probably null
PIT4402001:Mrps9 UTSW 1 42896098 missense probably benign 0.10
R0598:Mrps9 UTSW 1 42905417 missense probably damaging 1.00
R1718:Mrps9 UTSW 1 42903399 missense probably damaging 1.00
R4195:Mrps9 UTSW 1 42901094 intron probably benign
R4196:Mrps9 UTSW 1 42901094 intron probably benign
R4695:Mrps9 UTSW 1 42862515 missense possibly damaging 0.59
R4840:Mrps9 UTSW 1 42898415 intron probably benign
R5033:Mrps9 UTSW 1 42895331 splice site probably null
R5489:Mrps9 UTSW 1 42898433 splice site probably benign
R5876:Mrps9 UTSW 1 42895378 missense probably damaging 0.99
R7015:Mrps9 UTSW 1 42898546 missense probably benign 0.04
R7940:Mrps9 UTSW 1 42862648 missense probably damaging 0.98
R8679:Mrps9 UTSW 1 42879755 missense probably damaging 0.99
R9117:Mrps9 UTSW 1 42903377 missense probably benign 0.22
Z1177:Mrps9 UTSW 1 42899458 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- AAAAGACGCATAAACCGTTGCTG -3'
(R):5'- GTAAACTCAAGACGATGTGTACAC -3'

Sequencing Primer
(F):5'- CATAAACCGTTGCTGTCAGTTG -3'
(R):5'- CAAGACGATGTGTACACGCTGC -3'
Posted On 2018-10-18