Incidental Mutation 'R6891:Olfr670'
ID537214
Institutional Source Beutler Lab
Gene Symbol Olfr670
Ensembl Gene ENSMUSG00000044705
Gene Nameolfactory receptor 670
SynonymsMOR32-8, GA_x6K02T2PBJ9-7589577-7588639
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R6891 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location104957114-104962620 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 104959985 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 249 (I249T)
Ref Sequence ENSEMBL: ENSMUSP00000151138 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050482] [ENSMUST00000214216]
Predicted Effect probably damaging
Transcript: ENSMUST00000050482
AA Change: I249T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000060289
Gene: ENSMUSG00000044705
AA Change: I249T

DomainStartEndE-ValueType
Pfam:7tm_4 33 311 3.7e-121 PFAM
Pfam:7TM_GPCR_Srsx 37 211 4.5e-7 PFAM
Pfam:7tm_1 43 293 3.9e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214216
AA Change: I249T

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Meta Mutation Damage Score 0.1625 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 97% (72/74)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833423E24Rik C A 2: 85,488,805 M384I possibly damaging Het
4833423E24Rik T G 2: 85,488,813 T382P probably damaging Het
Actl11 C T 9: 107,929,147 A223V probably benign Het
Agbl5 G T 5: 30,895,178 R61L probably damaging Het
Agmat A T 4: 141,755,881 T209S probably benign Het
Ankrd34a G A 3: 96,598,019 V180I probably benign Het
Anks1 C T 17: 28,057,424 T1047M probably damaging Het
Arhgap21 T A 2: 20,850,331 I1407F probably damaging Het
Armc1 C A 3: 19,135,041 C183F probably damaging Het
Atg13 A G 2: 91,685,791 M196T probably benign Het
AU040320 G T 4: 126,846,438 S864I possibly damaging Het
Btn2a2 T C 13: 23,482,844 D197G probably benign Het
Carmil1 A G 13: 24,141,723 I208T probably benign Het
Cbs T A 17: 31,622,457 R263S probably damaging Het
Ccdc7a C A 8: 129,026,638 R204L probably damaging Het
Cdhr1 A T 14: 37,097,377 probably null Het
Cers4 G A 8: 4,523,731 R378Q probably damaging Het
Chst1 T G 2: 92,613,743 L187V probably benign Het
Clec4e A T 6: 123,283,606 N164K probably damaging Het
Cln3 T A 7: 126,582,803 D29V possibly damaging Het
Crybg2 A G 4: 134,081,837 S187G probably benign Het
Ddx1 A T 12: 13,236,095 N285K probably benign Het
Dmxl2 A G 9: 54,480,380 I58T probably damaging Het
Dock4 A G 12: 40,779,136 Y1007C probably damaging Het
Eral1 C T 11: 78,075,733 V234I possibly damaging Het
Fam161b A G 12: 84,354,780 F400S probably damaging Het
Fmnl3 T C 15: 99,325,873 D314G probably damaging Het
Foxred2 A T 15: 77,955,709 L127Q probably damaging Het
Gjd2 G A 2: 114,013,094 A14V possibly damaging Het
Gm3106 C A 5: 94,218,119 P32Q probably damaging Het
Gon4l A G 3: 88,858,866 probably null Het
Gpr151 T A 18: 42,578,920 D231V probably benign Het
Gzf1 A T 2: 148,684,769 K387* probably null Het
Hfm1 T A 5: 106,917,374 K146N possibly damaging Het
Hgf G A 5: 16,604,922 probably null Het
Isoc2b A G 7: 4,851,488 S15P probably damaging Het
Itga5 A G 15: 103,357,543 S126P probably damaging Het
Kat6b A G 14: 21,669,036 D1152G probably benign Het
Kcna4 C T 2: 107,296,307 S462F probably damaging Het
Kif24 A T 4: 41,394,168 C902S probably benign Het
Lama2 A T 10: 27,328,072 C523* probably null Het
Lama2 G C 10: 27,328,082 S520* probably null Het
Ltf T C 9: 111,025,113 V332A probably benign Het
Mapkap1 T C 2: 34,563,141 F349L probably damaging Het
Mdm1 A G 10: 118,148,032 N188D probably benign Het
Mfn1 T C 3: 32,577,103 S730P possibly damaging Het
Mrgprd T A 7: 145,322,350 D319E probably benign Het
Mrps9 C A 1: 42,905,413 L364I probably damaging Het
Myo1h C T 5: 114,349,612 R626C probably damaging Het
Nme3 T C 17: 24,896,855 S61P probably benign Het
Olfr123 A G 17: 37,795,504 Q20R probably benign Het
Pald1 A G 10: 61,348,532 probably null Het
Papola A T 12: 105,809,691 probably benign Het
Peg10 GAT GATCAT 6: 4,756,449 probably benign Het
Plch1 T C 3: 63,698,083 T1458A probably benign Het
Polr3e A G 7: 120,944,650 Q659R probably damaging Het
Shoc2 T C 19: 53,988,117 V146A probably benign Het
Slc15a1 T C 14: 121,476,030 T362A probably benign Het
Smpd3 A G 8: 106,264,668 Y418H probably damaging Het
Sorcs1 A T 19: 50,225,119 C723* probably null Het
Supt7l T A 5: 31,523,021 N16Y probably damaging Het
Syngr2 T C 11: 117,812,673 V105A probably damaging Het
Thrb T A 14: 17,981,899 V8E probably benign Het
Tlx1 A T 19: 45,151,318 I135F probably damaging Het
Tnfaip3 A G 10: 19,011,669 I36T probably damaging Het
Troap A G 15: 99,082,688 Y583C possibly damaging Het
Usp17lb T C 7: 104,841,100 K207E probably benign Het
Vmn2r10 C T 5: 109,001,979 V400M probably damaging Het
Wdr49 A T 3: 75,333,283 probably null Het
Wdr64 G T 1: 175,706,068 W90L probably damaging Het
Yme1l1 A G 2: 23,195,389 E662G probably damaging Het
Zfp334 C T 2: 165,382,724 V68I probably benign Het
Other mutations in Olfr670
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00978:Olfr670 APN 7 104960716 missense probably damaging 0.96
IGL01100:Olfr670 APN 7 104959995 missense probably benign 0.07
IGL01351:Olfr670 APN 7 104960739 start gained probably benign
IGL01478:Olfr670 APN 7 104960348 missense probably damaging 0.97
IGL01835:Olfr670 APN 7 104960462 missense probably benign 0.01
IGL02326:Olfr670 APN 7 104960646 missense probably benign 0.12
IGL02434:Olfr670 APN 7 104960072 missense probably benign 0.05
IGL02434:Olfr670 APN 7 104960074 nonsense probably null
IGL02968:Olfr670 APN 7 104960244 missense possibly damaging 0.90
R0055:Olfr670 UTSW 7 104960496 missense possibly damaging 0.46
R0055:Olfr670 UTSW 7 104960496 missense possibly damaging 0.46
R0345:Olfr670 UTSW 7 104960181 missense probably damaging 1.00
R0401:Olfr670 UTSW 7 104959943 missense probably damaging 1.00
R0646:Olfr670 UTSW 7 104959811 missense probably benign 0.02
R1493:Olfr670 UTSW 7 104960502 missense probably damaging 0.97
R1532:Olfr670 UTSW 7 104960265 missense probably benign
R1557:Olfr670 UTSW 7 104960540 missense probably damaging 0.99
R4072:Olfr670 UTSW 7 104960716 missense probably damaging 0.96
R4074:Olfr670 UTSW 7 104960716 missense probably damaging 0.96
R4075:Olfr670 UTSW 7 104960716 missense probably damaging 0.96
R4076:Olfr670 UTSW 7 104960716 missense probably damaging 0.96
R4229:Olfr670 UTSW 7 104960594 missense probably benign 0.18
R4230:Olfr670 UTSW 7 104960594 missense probably benign 0.18
R5374:Olfr670 UTSW 7 104959996 missense probably damaging 1.00
R6006:Olfr670 UTSW 7 104960663 missense probably damaging 0.99
R7465:Olfr670 UTSW 7 104959917 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- CATCTCTCTGAAATGGCTTATGTC -3'
(R):5'- ACACATGGGGATTGCTCGTC -3'

Sequencing Primer
(F):5'- TCTTCCAAAAGATGCTTAAAACCTG -3'
(R):5'- GGATTGCTCGTCTGGCC -3'
Posted On2018-10-18