Mutagenetix > Incidental Mutation

Incidental Mutation 'R6891:Slc15a1'

537240

Institutional Source

Beutler Lab

Gene Symbol

Slc15a1

Ensembl Gene

ENSMUSG00000025557

Gene Name

solute carrier family 15 (oligopeptide transporter), member 1

Synonyms

PECT1, PEPT1

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.052) question?

Stock #

R6891 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

121459621-121505252 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 121476030 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 362 (T362A)

Ref Sequence

ENSEMBL: ENSMUSP00000085728 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000088386]

AlphaFold

Q9JIP7

Predicted Effect

probably benign
Transcript: ENSMUST00000088386
AA Change: T362A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000085728
Gene: ENSMUSG00000025557
AA Change: T362A

Domain	Start	End	E-Value	Type
Pfam:PTR2	81	477	1.9e-141	PFAM
Pfam:PTR2	562	644	4.2e-11	PFAM
transmembrane domain	650	672	N/A	INTRINSIC
low complexity region	684	695	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.0%

Validation Efficiency

97% (72/74)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an intestinal hydrogen peptide cotransporter that is a member of the solute carrier family 15. The encoded protein is localized to the brush border membrane of the intestinal epithelium and mediates the uptake of di- and tripeptides from the lumen into the enterocytes. This protein plays an important role in the uptake and digestion of dietary proteins. This protein also facilitates the absorption of numerous peptidomimetic drugs. [provided by RefSeq, Apr 2010]
PHENOTYPE: Peptide uptake in the intestine is substantially reduced in mice homozygous for a null mutation of this gene. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 72 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4833423E24Rik	C	A	2: 85,488,805	M384I	possibly damaging	Het
4833423E24Rik	T	G	2: 85,488,813	T382P	probably damaging	Het
Actl11	C	T	9: 107,929,147	A223V	probably benign	Het
Agbl5	G	T	5: 30,895,178	R61L	probably damaging	Het
Agmat	A	T	4: 141,755,881	T209S	probably benign	Het
Ankrd34a	G	A	3: 96,598,019	V180I	probably benign	Het
Anks1	C	T	17: 28,057,424	T1047M	probably damaging	Het
Arhgap21	T	A	2: 20,850,331	I1407F	probably damaging	Het
Armc1	C	A	3: 19,135,041	C183F	probably damaging	Het
Atg13	A	G	2: 91,685,791	M196T	probably benign	Het
AU040320	G	T	4: 126,846,438	S864I	possibly damaging	Het
Btn2a2	T	C	13: 23,482,844	D197G	probably benign	Het
Carmil1	A	G	13: 24,141,723	I208T	probably benign	Het
Cbs	T	A	17: 31,622,457	R263S	probably damaging	Het
Ccdc7a	C	A	8: 129,026,638	R204L	probably damaging	Het
Cdhr1	A	T	14: 37,097,377		probably null	Het
Cers4	G	A	8: 4,523,731	R378Q	probably damaging	Het
Chst1	T	G	2: 92,613,743	L187V	probably benign	Het
Clec4e	A	T	6: 123,283,606	N164K	probably damaging	Het
Cln3	T	A	7: 126,582,803	D29V	possibly damaging	Het
Crybg2	A	G	4: 134,081,837	S187G	probably benign	Het
Ddx1	A	T	12: 13,236,095	N285K	probably benign	Het
Dmxl2	A	G	9: 54,480,380	I58T	probably damaging	Het
Dock4	A	G	12: 40,779,136	Y1007C	probably damaging	Het
Eral1	C	T	11: 78,075,733	V234I	possibly damaging	Het
Fam161b	A	G	12: 84,354,780	F400S	probably damaging	Het
Fmnl3	T	C	15: 99,325,873	D314G	probably damaging	Het
Foxred2	A	T	15: 77,955,709	L127Q	probably damaging	Het
Gjd2	G	A	2: 114,013,094	A14V	possibly damaging	Het
Gm3106	C	A	5: 94,218,119	P32Q	probably damaging	Het
Gon4l	A	G	3: 88,858,866		probably null	Het
Gpr151	T	A	18: 42,578,920	D231V	probably benign	Het
Gzf1	A	T	2: 148,684,769	K387*	probably null	Het
Hfm1	T	A	5: 106,917,374	K146N	possibly damaging	Het
Hgf	G	A	5: 16,604,922		probably null	Het
Isoc2b	A	G	7: 4,851,488	S15P	probably damaging	Het
Itga5	A	G	15: 103,357,543	S126P	probably damaging	Het
Kat6b	A	G	14: 21,669,036	D1152G	probably benign	Het
Kcna4	C	T	2: 107,296,307	S462F	probably damaging	Het
Kif24	A	T	4: 41,394,168	C902S	probably benign	Het
Lama2	A	T	10: 27,328,072	C523*	probably null	Het
Lama2	G	C	10: 27,328,082	S520*	probably null	Het
Ltf	T	C	9: 111,025,113	V332A	probably benign	Het
Mapkap1	T	C	2: 34,563,141	F349L	probably damaging	Het
Mdm1	A	G	10: 118,148,032	N188D	probably benign	Het
Mfn1	T	C	3: 32,577,103	S730P	possibly damaging	Het
Mrgprd	T	A	7: 145,322,350	D319E	probably benign	Het
Mrps9	C	A	1: 42,905,413	L364I	probably damaging	Het
Myo1h	C	T	5: 114,349,612	R626C	probably damaging	Het
Nme3	T	C	17: 24,896,855	S61P	probably benign	Het
Olfr123	A	G	17: 37,795,504	Q20R	probably benign	Het
Olfr670	A	G	7: 104,959,985	I249T	probably damaging	Het
Pald1	A	G	10: 61,348,532		probably null	Het
Papola	A	T	12: 105,809,691		probably benign	Het
Peg10	GAT	GATCAT	6: 4,756,449		probably benign	Het
Plch1	T	C	3: 63,698,083	T1458A	probably benign	Het
Polr3e	A	G	7: 120,944,650	Q659R	probably damaging	Het
Shoc2	T	C	19: 53,988,117	V146A	probably benign	Het
Smpd3	A	G	8: 106,264,668	Y418H	probably damaging	Het
Sorcs1	A	T	19: 50,225,119	C723*	probably null	Het
Supt7l	T	A	5: 31,523,021	N16Y	probably damaging	Het
Syngr2	T	C	11: 117,812,673	V105A	probably damaging	Het
Thrb	T	A	14: 17,981,899	V8E	probably benign	Het
Tlx1	A	T	19: 45,151,318	I135F	probably damaging	Het
Tnfaip3	A	G	10: 19,011,669	I36T	probably damaging	Het
Troap	A	G	15: 99,082,688	Y583C	possibly damaging	Het
Usp17lb	T	C	7: 104,841,100	K207E	probably benign	Het
Vmn2r10	C	T	5: 109,001,979	V400M	probably damaging	Het
Wdr49	A	T	3: 75,333,283		probably null	Het
Wdr64	G	T	1: 175,706,068	W90L	probably damaging	Het
Yme1l1	A	G	2: 23,195,389	E662G	probably damaging	Het
Zfp334	C	T	2: 165,382,724	V68I	probably benign	Het

Other mutations in Slc15a1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01337:Slc15a1	APN	14	121460679	missense	possibly damaging	0.95
IGL01534:Slc15a1	APN	14	121464952	missense	possibly damaging	0.95
IGL01783:Slc15a1	APN	14	121471276	critical splice donor site	probably null
IGL01799:Slc15a1	APN	14	121480729	missense	possibly damaging	0.76
IGL02064:Slc15a1	APN	14	121462499	missense	possibly damaging	0.66
IGL02064:Slc15a1	APN	14	121462474	missense	probably benign	0.20
IGL02115:Slc15a1	APN	14	121480661	missense	possibly damaging	0.61
IGL02514:Slc15a1	APN	14	121487040	missense	probably damaging	1.00
IGL03056:Slc15a1	APN	14	121491283	missense	possibly damaging	0.82
IGL03297:Slc15a1	APN	14	121486684	missense	probably damaging	1.00
R1484:Slc15a1	UTSW	14	121491239	nonsense	probably null
R1532:Slc15a1	UTSW	14	121475984	missense	possibly damaging	0.79
R1655:Slc15a1	UTSW	14	121465899	missense	probably benign	0.34
R2013:Slc15a1	UTSW	14	121475987	missense	possibly damaging	0.88
R2270:Slc15a1	UTSW	14	121479994	missense	probably damaging	0.99
R2878:Slc15a1	UTSW	14	121465933	missense	probably benign	0.00
R2986:Slc15a1	UTSW	14	121489809	missense	probably benign	0.02
R3862:Slc15a1	UTSW	14	121484857	missense	probably benign	0.06
R3863:Slc15a1	UTSW	14	121484857	missense	probably benign	0.06
R3978:Slc15a1	UTSW	14	121489827	missense	probably benign	0.00
R4184:Slc15a1	UTSW	14	121466162	missense	probably benign	0.00
R4573:Slc15a1	UTSW	14	121487029	missense	probably damaging	0.99
R4604:Slc15a1	UTSW	14	121489907	missense	probably damaging	1.00
R4649:Slc15a1	UTSW	14	121478092	missense	probably damaging	1.00
R5838:Slc15a1	UTSW	14	121484871	missense	probably damaging	1.00
R6221:Slc15a1	UTSW	14	121464904	missense	probably null	1.00
R7626:Slc15a1	UTSW	14	121475965	missense	probably benign	0.13
R7836:Slc15a1	UTSW	14	121480733	nonsense	probably null
R8284:Slc15a1	UTSW	14	121489863	missense	probably benign	0.01
R8376:Slc15a1	UTSW	14	121480703	missense	probably benign
R8408:Slc15a1	UTSW	14	121478116	missense	possibly damaging	0.91
R8774:Slc15a1	UTSW	14	121487011	missense	probably damaging	1.00
R8774-TAIL:Slc15a1	UTSW	14	121487011	missense	probably damaging	1.00
R8933:Slc15a1	UTSW	14	121486679	missense	probably benign	0.00
R9157:Slc15a1	UTSW	14	121464977	missense	probably benign	0.08
Z1088:Slc15a1	UTSW	14	121480054	missense	probably benign	0.09
Z1088:Slc15a1	UTSW	14	121491044	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATGGACTACTTTGCCCCACC -3'
(R):5'- GGGCATATACTCACATTGACATGC -3'

Sequencing Primer
(F):5'- ACCCCCGCCCTGTACTG -3'
(R):5'- ATACTCACATTGACATGCATACG -3'

Posted On

2018-10-18