Incidental Mutation 'R6891:Slc15a1'
ID537240
Institutional Source Beutler Lab
Gene Symbol Slc15a1
Ensembl Gene ENSMUSG00000025557
Gene Namesolute carrier family 15 (oligopeptide transporter), member 1
SynonymsPECT1, PEPT1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R6891 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location121459621-121505252 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 121476030 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 362 (T362A)
Ref Sequence ENSEMBL: ENSMUSP00000085728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088386]
Predicted Effect probably benign
Transcript: ENSMUST00000088386
AA Change: T362A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000085728
Gene: ENSMUSG00000025557
AA Change: T362A

DomainStartEndE-ValueType
Pfam:PTR2 81 477 1.9e-141 PFAM
Pfam:PTR2 562 644 4.2e-11 PFAM
transmembrane domain 650 672 N/A INTRINSIC
low complexity region 684 695 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 97% (72/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an intestinal hydrogen peptide cotransporter that is a member of the solute carrier family 15. The encoded protein is localized to the brush border membrane of the intestinal epithelium and mediates the uptake of di- and tripeptides from the lumen into the enterocytes. This protein plays an important role in the uptake and digestion of dietary proteins. This protein also facilitates the absorption of numerous peptidomimetic drugs. [provided by RefSeq, Apr 2010]
PHENOTYPE: Peptide uptake in the intestine is substantially reduced in mice homozygous for a null mutation of this gene. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833423E24Rik C A 2: 85,488,805 M384I possibly damaging Het
4833423E24Rik T G 2: 85,488,813 T382P probably damaging Het
Actl11 C T 9: 107,929,147 A223V probably benign Het
Agbl5 G T 5: 30,895,178 R61L probably damaging Het
Agmat A T 4: 141,755,881 T209S probably benign Het
Ankrd34a G A 3: 96,598,019 V180I probably benign Het
Anks1 C T 17: 28,057,424 T1047M probably damaging Het
Arhgap21 T A 2: 20,850,331 I1407F probably damaging Het
Armc1 C A 3: 19,135,041 C183F probably damaging Het
Atg13 A G 2: 91,685,791 M196T probably benign Het
AU040320 G T 4: 126,846,438 S864I possibly damaging Het
Btn2a2 T C 13: 23,482,844 D197G probably benign Het
Carmil1 A G 13: 24,141,723 I208T probably benign Het
Cbs T A 17: 31,622,457 R263S probably damaging Het
Ccdc7a C A 8: 129,026,638 R204L probably damaging Het
Cdhr1 A T 14: 37,097,377 probably null Het
Cers4 G A 8: 4,523,731 R378Q probably damaging Het
Chst1 T G 2: 92,613,743 L187V probably benign Het
Clec4e A T 6: 123,283,606 N164K probably damaging Het
Cln3 T A 7: 126,582,803 D29V possibly damaging Het
Crybg2 A G 4: 134,081,837 S187G probably benign Het
Ddx1 A T 12: 13,236,095 N285K probably benign Het
Dmxl2 A G 9: 54,480,380 I58T probably damaging Het
Dock4 A G 12: 40,779,136 Y1007C probably damaging Het
Eral1 C T 11: 78,075,733 V234I possibly damaging Het
Fam161b A G 12: 84,354,780 F400S probably damaging Het
Fmnl3 T C 15: 99,325,873 D314G probably damaging Het
Foxred2 A T 15: 77,955,709 L127Q probably damaging Het
Gjd2 G A 2: 114,013,094 A14V possibly damaging Het
Gm3106 C A 5: 94,218,119 P32Q probably damaging Het
Gon4l A G 3: 88,858,866 probably null Het
Gpr151 T A 18: 42,578,920 D231V probably benign Het
Gzf1 A T 2: 148,684,769 K387* probably null Het
Hfm1 T A 5: 106,917,374 K146N possibly damaging Het
Hgf G A 5: 16,604,922 probably null Het
Isoc2b A G 7: 4,851,488 S15P probably damaging Het
Itga5 A G 15: 103,357,543 S126P probably damaging Het
Kat6b A G 14: 21,669,036 D1152G probably benign Het
Kcna4 C T 2: 107,296,307 S462F probably damaging Het
Kif24 A T 4: 41,394,168 C902S probably benign Het
Lama2 A T 10: 27,328,072 C523* probably null Het
Lama2 G C 10: 27,328,082 S520* probably null Het
Ltf T C 9: 111,025,113 V332A probably benign Het
Mapkap1 T C 2: 34,563,141 F349L probably damaging Het
Mdm1 A G 10: 118,148,032 N188D probably benign Het
Mfn1 T C 3: 32,577,103 S730P possibly damaging Het
Mrgprd T A 7: 145,322,350 D319E probably benign Het
Mrps9 C A 1: 42,905,413 L364I probably damaging Het
Myo1h C T 5: 114,349,612 R626C probably damaging Het
Nme3 T C 17: 24,896,855 S61P probably benign Het
Olfr123 A G 17: 37,795,504 Q20R probably benign Het
Olfr670 A G 7: 104,959,985 I249T probably damaging Het
Pald1 A G 10: 61,348,532 probably null Het
Papola A T 12: 105,809,691 probably benign Het
Peg10 GAT GATCAT 6: 4,756,449 probably benign Het
Plch1 T C 3: 63,698,083 T1458A probably benign Het
Polr3e A G 7: 120,944,650 Q659R probably damaging Het
Shoc2 T C 19: 53,988,117 V146A probably benign Het
Smpd3 A G 8: 106,264,668 Y418H probably damaging Het
Sorcs1 A T 19: 50,225,119 C723* probably null Het
Supt7l T A 5: 31,523,021 N16Y probably damaging Het
Syngr2 T C 11: 117,812,673 V105A probably damaging Het
Thrb T A 14: 17,981,899 V8E probably benign Het
Tlx1 A T 19: 45,151,318 I135F probably damaging Het
Tnfaip3 A G 10: 19,011,669 I36T probably damaging Het
Troap A G 15: 99,082,688 Y583C possibly damaging Het
Usp17lb T C 7: 104,841,100 K207E probably benign Het
Vmn2r10 C T 5: 109,001,979 V400M probably damaging Het
Wdr49 A T 3: 75,333,283 probably null Het
Wdr64 G T 1: 175,706,068 W90L probably damaging Het
Yme1l1 A G 2: 23,195,389 E662G probably damaging Het
Zfp334 C T 2: 165,382,724 V68I probably benign Het
Other mutations in Slc15a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01337:Slc15a1 APN 14 121460679 missense possibly damaging 0.95
IGL01534:Slc15a1 APN 14 121464952 missense possibly damaging 0.95
IGL01783:Slc15a1 APN 14 121471276 critical splice donor site probably null
IGL01799:Slc15a1 APN 14 121480729 missense possibly damaging 0.76
IGL02064:Slc15a1 APN 14 121462499 missense possibly damaging 0.66
IGL02064:Slc15a1 APN 14 121462474 missense probably benign 0.20
IGL02115:Slc15a1 APN 14 121480661 missense possibly damaging 0.61
IGL02514:Slc15a1 APN 14 121487040 missense probably damaging 1.00
IGL03056:Slc15a1 APN 14 121491283 missense possibly damaging 0.82
IGL03297:Slc15a1 APN 14 121486684 missense probably damaging 1.00
R1484:Slc15a1 UTSW 14 121491239 nonsense probably null
R1532:Slc15a1 UTSW 14 121475984 missense possibly damaging 0.79
R1655:Slc15a1 UTSW 14 121465899 missense probably benign 0.34
R2013:Slc15a1 UTSW 14 121475987 missense possibly damaging 0.88
R2270:Slc15a1 UTSW 14 121479994 missense probably damaging 0.99
R2878:Slc15a1 UTSW 14 121465933 missense probably benign 0.00
R2986:Slc15a1 UTSW 14 121489809 missense probably benign 0.02
R3862:Slc15a1 UTSW 14 121484857 missense probably benign 0.06
R3863:Slc15a1 UTSW 14 121484857 missense probably benign 0.06
R3978:Slc15a1 UTSW 14 121489827 missense probably benign 0.00
R4184:Slc15a1 UTSW 14 121466162 missense probably benign 0.00
R4573:Slc15a1 UTSW 14 121487029 missense probably damaging 0.99
R4604:Slc15a1 UTSW 14 121489907 missense probably damaging 1.00
R4649:Slc15a1 UTSW 14 121478092 missense probably damaging 1.00
R5838:Slc15a1 UTSW 14 121484871 missense probably damaging 1.00
R6221:Slc15a1 UTSW 14 121464904 missense probably null 1.00
R7626:Slc15a1 UTSW 14 121475965 missense probably benign 0.13
R7836:Slc15a1 UTSW 14 121480733 nonsense probably null
R8284:Slc15a1 UTSW 14 121489863 missense probably benign 0.01
R8376:Slc15a1 UTSW 14 121480703 missense probably benign
R8408:Slc15a1 UTSW 14 121478116 missense possibly damaging 0.91
Z1088:Slc15a1 UTSW 14 121480054 missense probably benign 0.09
Z1088:Slc15a1 UTSW 14 121491044 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGGACTACTTTGCCCCACC -3'
(R):5'- GGGCATATACTCACATTGACATGC -3'

Sequencing Primer
(F):5'- ACCCCCGCCCTGTACTG -3'
(R):5'- ATACTCACATTGACATGCATACG -3'
Posted On2018-10-18