Incidental Mutation 'R6891:Sorcs1'
ID 537251
Institutional Source Beutler Lab
Gene Symbol Sorcs1
Ensembl Gene ENSMUSG00000043531
Gene Name sortilin-related VPS10 domain containing receptor 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock # R6891 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 50143299-50678646 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 50225119 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Stop codon at position 723 (C723*)
Ref Sequence ENSEMBL: ENSMUSP00000147591 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072685] [ENSMUST00000111756] [ENSMUST00000164039] [ENSMUST00000209413] [ENSMUST00000209783] [ENSMUST00000211008] [ENSMUST00000211687]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000072685
AA Change: C723*
SMART Domains Protein: ENSMUSP00000072472
Gene: ENSMUSG00000043531
AA Change: C723*

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 94 113 N/A INTRINSIC
VPS10 196 797 N/A SMART
PKD 799 889 3.84e-1 SMART
PKD 897 975 8.63e-1 SMART
transmembrane domain 1098 1120 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000111756
AA Change: C723*
SMART Domains Protein: ENSMUSP00000107386
Gene: ENSMUSG00000043531
AA Change: C723*

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 94 113 N/A INTRINSIC
VPS10 196 797 N/A SMART
PKD 799 889 3.84e-1 SMART
PKD 897 975 8.63e-1 SMART
transmembrane domain 1098 1120 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000164039
AA Change: C723*
SMART Domains Protein: ENSMUSP00000132615
Gene: ENSMUSG00000043531
AA Change: C723*

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 94 113 N/A INTRINSIC
VPS10 196 797 N/A SMART
PKD 799 889 3.84e-1 SMART
PKD 897 975 8.63e-1 SMART
transmembrane domain 1098 1120 N/A INTRINSIC
low complexity region 1129 1142 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168357
SMART Domains Protein: ENSMUSP00000129190
Gene: ENSMUSG00000043531

DomainStartEndE-ValueType
VPS10 1 320 6.99e-58 SMART
PKD 322 412 3.84e-1 SMART
PKD 420 498 8.63e-1 SMART
transmembrane domain 621 643 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000209413
AA Change: C723*
Predicted Effect probably null
Transcript: ENSMUST00000209783
AA Change: C723*
Predicted Effect probably null
Transcript: ENSMUST00000211008
AA Change: C723*
Predicted Effect probably null
Transcript: ENSMUST00000211687
AA Change: C723*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 97% (72/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one family member of vacuolar protein sorting 10 (VPS10) domain-containing receptor proteins. The VPS10 domain name comes from the yeast carboxypeptidase Y sorting receptor Vps10 protein. Members of this gene family are large with many exons but the CDS lengths are usually less than 3700 nt. Very large introns typically separate the exons encoding the VPS10 domain; the remaining exons are separated by much smaller-sized introns. These genes are strongly expressed in the central nervous system. Two of the five family members (sortilin and sortilin-related receptor) are synthesized as preproproteins; it is not yet known if this encoded protein is also a preproprotein. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Female mice homozygous for a null allele have abnormal amyloid beta levels in the brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833423E24Rik C A 2: 85,488,805 M384I possibly damaging Het
4833423E24Rik T G 2: 85,488,813 T382P probably damaging Het
Actl11 C T 9: 107,929,147 A223V probably benign Het
Agbl5 G T 5: 30,895,178 R61L probably damaging Het
Agmat A T 4: 141,755,881 T209S probably benign Het
Ankrd34a G A 3: 96,598,019 V180I probably benign Het
Anks1 C T 17: 28,057,424 T1047M probably damaging Het
Arhgap21 T A 2: 20,850,331 I1407F probably damaging Het
Armc1 C A 3: 19,135,041 C183F probably damaging Het
Atg13 A G 2: 91,685,791 M196T probably benign Het
AU040320 G T 4: 126,846,438 S864I possibly damaging Het
Btn2a2 T C 13: 23,482,844 D197G probably benign Het
Carmil1 A G 13: 24,141,723 I208T probably benign Het
Cbs T A 17: 31,622,457 R263S probably damaging Het
Ccdc7a C A 8: 129,026,638 R204L probably damaging Het
Cdhr1 A T 14: 37,097,377 probably null Het
Cers4 G A 8: 4,523,731 R378Q probably damaging Het
Chst1 T G 2: 92,613,743 L187V probably benign Het
Clec4e A T 6: 123,283,606 N164K probably damaging Het
Cln3 T A 7: 126,582,803 D29V possibly damaging Het
Crybg2 A G 4: 134,081,837 S187G probably benign Het
Ddx1 A T 12: 13,236,095 N285K probably benign Het
Dmxl2 A G 9: 54,480,380 I58T probably damaging Het
Dock4 A G 12: 40,779,136 Y1007C probably damaging Het
Eral1 C T 11: 78,075,733 V234I possibly damaging Het
Fam161b A G 12: 84,354,780 F400S probably damaging Het
Fmnl3 T C 15: 99,325,873 D314G probably damaging Het
Foxred2 A T 15: 77,955,709 L127Q probably damaging Het
Gjd2 G A 2: 114,013,094 A14V possibly damaging Het
Gm3106 C A 5: 94,218,119 P32Q probably damaging Het
Gon4l A G 3: 88,858,866 probably null Het
Gpr151 T A 18: 42,578,920 D231V probably benign Het
Gzf1 A T 2: 148,684,769 K387* probably null Het
Hfm1 T A 5: 106,917,374 K146N possibly damaging Het
Hgf G A 5: 16,604,922 probably null Het
Isoc2b A G 7: 4,851,488 S15P probably damaging Het
Itga5 A G 15: 103,357,543 S126P probably damaging Het
Kat6b A G 14: 21,669,036 D1152G probably benign Het
Kcna4 C T 2: 107,296,307 S462F probably damaging Het
Kif24 A T 4: 41,394,168 C902S probably benign Het
Lama2 A T 10: 27,328,072 C523* probably null Het
Lama2 G C 10: 27,328,082 S520* probably null Het
Ltf T C 9: 111,025,113 V332A probably benign Het
Mapkap1 T C 2: 34,563,141 F349L probably damaging Het
Mdm1 A G 10: 118,148,032 N188D probably benign Het
Mfn1 T C 3: 32,577,103 S730P possibly damaging Het
Mrgprd T A 7: 145,322,350 D319E probably benign Het
Mrps9 C A 1: 42,905,413 L364I probably damaging Het
Myo1h C T 5: 114,349,612 R626C probably damaging Het
Nme3 T C 17: 24,896,855 S61P probably benign Het
Olfr123 A G 17: 37,795,504 Q20R probably benign Het
Olfr670 A G 7: 104,959,985 I249T probably damaging Het
Pald1 A G 10: 61,348,532 probably null Het
Papola A T 12: 105,809,691 probably benign Het
Peg10 GAT GATCAT 6: 4,756,449 probably benign Het
Plch1 T C 3: 63,698,083 T1458A probably benign Het
Polr3e A G 7: 120,944,650 Q659R probably damaging Het
Shoc2 T C 19: 53,988,117 V146A probably benign Het
Slc15a1 T C 14: 121,476,030 T362A probably benign Het
Smpd3 A G 8: 106,264,668 Y418H probably damaging Het
Supt7l T A 5: 31,523,021 N16Y probably damaging Het
Syngr2 T C 11: 117,812,673 V105A probably damaging Het
Thrb T A 14: 17,981,899 V8E probably benign Het
Tlx1 A T 19: 45,151,318 I135F probably damaging Het
Tnfaip3 A G 10: 19,011,669 I36T probably damaging Het
Troap A G 15: 99,082,688 Y583C possibly damaging Het
Usp17lb T C 7: 104,841,100 K207E probably benign Het
Vmn2r10 C T 5: 109,001,979 V400M probably damaging Het
Wdr49 A T 3: 75,333,283 probably null Het
Wdr64 G T 1: 175,706,068 W90L probably damaging Het
Yme1l1 A G 2: 23,195,389 E662G probably damaging Het
Zfp334 C T 2: 165,382,724 V68I probably benign Het
Other mutations in Sorcs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Sorcs1 APN 19 50190054 missense probably damaging 1.00
IGL00983:Sorcs1 APN 19 50176128 missense probably damaging 0.98
IGL01125:Sorcs1 APN 19 50228201 missense probably damaging 1.00
IGL01320:Sorcs1 APN 19 50288079 splice site probably benign
IGL01445:Sorcs1 APN 19 50153066 missense probably damaging 1.00
IGL01682:Sorcs1 APN 19 50181506 missense probably benign 0.43
IGL01799:Sorcs1 APN 19 50230209 critical splice donor site probably null
IGL02044:Sorcs1 APN 19 50288159 splice site probably benign
IGL02111:Sorcs1 APN 19 50230245 missense probably benign 0.00
IGL02364:Sorcs1 APN 19 50333598 missense probably damaging 1.00
IGL02378:Sorcs1 APN 19 50182671 nonsense probably null
IGL02498:Sorcs1 APN 19 50678168 missense probably benign
IGL02658:Sorcs1 APN 19 50190092 missense probably damaging 1.00
IGL02939:Sorcs1 APN 19 50677930 nonsense probably null
IGL02942:Sorcs1 APN 19 50475437 missense probably damaging 1.00
IGL03057:Sorcs1 APN 19 50259756 nonsense probably null
IGL03230:Sorcs1 APN 19 50242093 missense probably damaging 1.00
P0033:Sorcs1 UTSW 19 50152907 missense probably damaging 0.98
R0109:Sorcs1 UTSW 19 50378891 splice site probably benign
R0115:Sorcs1 UTSW 19 50636453 intron probably benign
R0242:Sorcs1 UTSW 19 50228221 missense probably damaging 1.00
R0242:Sorcs1 UTSW 19 50228221 missense probably damaging 1.00
R0325:Sorcs1 UTSW 19 50313042 splice site probably null
R0481:Sorcs1 UTSW 19 50636453 intron probably benign
R0581:Sorcs1 UTSW 19 50252701 missense possibly damaging 0.70
R0669:Sorcs1 UTSW 19 50241942 splice site probably benign
R0980:Sorcs1 UTSW 19 50232323 missense probably benign 0.04
R1158:Sorcs1 UTSW 19 50144160 unclassified probably benign
R1519:Sorcs1 UTSW 19 50252587 missense probably benign 0.05
R1669:Sorcs1 UTSW 19 50475422 missense probably damaging 0.99
R1779:Sorcs1 UTSW 19 50175043 splice site probably benign
R1783:Sorcs1 UTSW 19 50228309 critical splice acceptor site probably null
R1927:Sorcs1 UTSW 19 50222195 missense probably damaging 1.00
R1935:Sorcs1 UTSW 19 50232644 missense probably damaging 0.96
R1936:Sorcs1 UTSW 19 50232644 missense probably damaging 0.96
R2109:Sorcs1 UTSW 19 50678192 missense probably benign
R2206:Sorcs1 UTSW 19 50230217 missense possibly damaging 0.81
R2207:Sorcs1 UTSW 19 50230217 missense possibly damaging 0.81
R3031:Sorcs1 UTSW 19 50225175 missense probably damaging 0.98
R3032:Sorcs1 UTSW 19 50225175 missense probably damaging 0.98
R3107:Sorcs1 UTSW 19 50210650 missense possibly damaging 0.83
R3508:Sorcs1 UTSW 19 50225175 missense probably damaging 0.98
R3738:Sorcs1 UTSW 19 50151221 missense probably benign 0.03
R4127:Sorcs1 UTSW 19 50222159 missense probably benign 0.29
R4212:Sorcs1 UTSW 19 50225175 missense probably damaging 0.98
R4213:Sorcs1 UTSW 19 50225175 missense probably damaging 0.98
R4385:Sorcs1 UTSW 19 50190161 missense probably benign 0.01
R4424:Sorcs1 UTSW 19 50378941 missense probably damaging 0.97
R4603:Sorcs1 UTSW 19 50312964 critical splice donor site probably null
R4679:Sorcs1 UTSW 19 50182669 missense probably benign
R4780:Sorcs1 UTSW 19 50143981 unclassified probably benign
R4781:Sorcs1 UTSW 19 50182681 missense probably damaging 1.00
R4823:Sorcs1 UTSW 19 50678140 missense possibly damaging 0.92
R4823:Sorcs1 UTSW 19 50230302 missense possibly damaging 0.87
R4883:Sorcs1 UTSW 19 50232303 missense probably benign 0.00
R5091:Sorcs1 UTSW 19 50259752 critical splice donor site probably null
R5105:Sorcs1 UTSW 19 50225141 missense possibly damaging 0.57
R5437:Sorcs1 UTSW 19 50252602 missense probably benign 0.19
R5574:Sorcs1 UTSW 19 50222133 missense probably damaging 1.00
R5734:Sorcs1 UTSW 19 50182775 missense probably benign 0.04
R6045:Sorcs1 UTSW 19 50190117 nonsense probably null
R6091:Sorcs1 UTSW 19 50288101 missense possibly damaging 0.64
R6119:Sorcs1 UTSW 19 50288094 missense probably damaging 0.98
R6226:Sorcs1 UTSW 19 50181414 missense probably damaging 1.00
R6337:Sorcs1 UTSW 19 50144124 missense probably benign 0.00
R6378:Sorcs1 UTSW 19 50225177 missense possibly damaging 0.57
R6782:Sorcs1 UTSW 19 50176122 nonsense probably null
R6792:Sorcs1 UTSW 19 50678168 missense probably benign
R7151:Sorcs1 UTSW 19 50312982 missense probably damaging 1.00
R7223:Sorcs1 UTSW 19 50190042 missense probably benign 0.06
R7356:Sorcs1 UTSW 19 50175157 missense possibly damaging 0.86
R7471:Sorcs1 UTSW 19 50262263 missense probably damaging 1.00
R7474:Sorcs1 UTSW 19 50153112 missense possibly damaging 0.65
R7503:Sorcs1 UTSW 19 50153052 missense probably benign
R7506:Sorcs1 UTSW 19 50182674 nonsense probably null
R7573:Sorcs1 UTSW 19 50152796 nonsense probably null
R7867:Sorcs1 UTSW 19 50230260 nonsense probably null
R7911:Sorcs1 UTSW 19 50144032 missense unknown
R8032:Sorcs1 UTSW 19 50475408 missense probably benign 0.28
R8063:Sorcs1 UTSW 19 50143977 missense unknown
R8463:Sorcs1 UTSW 19 50259810 missense probably damaging 1.00
R8682:Sorcs1 UTSW 19 50378960 missense probably damaging 0.99
R8724:Sorcs1 UTSW 19 50151220 missense probably benign 0.33
R8926:Sorcs1 UTSW 19 50252658 missense possibly damaging 0.94
R9160:Sorcs1 UTSW 19 50225220 missense probably damaging 1.00
R9173:Sorcs1 UTSW 19 50232315 missense possibly damaging 0.92
R9203:Sorcs1 UTSW 19 50262295 missense probably damaging 1.00
R9229:Sorcs1 UTSW 19 50152862 missense probably benign 0.17
R9398:Sorcs1 UTSW 19 50225213 missense possibly damaging 0.90
R9430:Sorcs1 UTSW 19 50210770 missense probably damaging 1.00
R9510:Sorcs1 UTSW 19 50678083 missense probably benign 0.04
R9511:Sorcs1 UTSW 19 50678083 missense probably benign 0.04
R9744:Sorcs1 UTSW 19 50226837 missense probably damaging 1.00
R9777:Sorcs1 UTSW 19 50259752 critical splice donor site probably null
X0024:Sorcs1 UTSW 19 50182763 missense possibly damaging 0.92
Z1088:Sorcs1 UTSW 19 50222143 missense probably benign 0.16
Z1177:Sorcs1 UTSW 19 50226742 missense probably null 1.00
Z1177:Sorcs1 UTSW 19 50333599 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCAAAGAAGAAACCGCTGATTTC -3'
(R):5'- GGCTGCAGGAGAAGTCTAATC -3'

Sequencing Primer
(F):5'- GAAGAAACCGCTGATTTCTTTTG -3'
(R):5'- CAGGAGAAGTCTAATCTTTGTGC -3'
Posted On 2018-10-18