Incidental Mutation 'R6815:Trmt6'
List |< first << previous [record 49 of 53] next >> last >|
ID537262
Institutional Source Beutler Lab
Gene Symbol Trmt6
Ensembl Gene ENSMUSG00000037376
Gene NametRNA methyltransferase 6
Synonyms3300001M20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.916) question?
Stock #R6815 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location132804207-132816055 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 132809858 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 214 (V214G)
Ref Sequence ENSEMBL: ENSMUSP00000044687 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039554]
Predicted Effect probably damaging
Transcript: ENSMUST00000039554
AA Change: V214G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044687
Gene: ENSMUSG00000037376
AA Change: V214G

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:Gcd10p 20 302 7.2e-74 PFAM
coiled coil region 345 364 N/A INTRINSIC
low complexity region 444 456 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tRNA methyltransferase 6 protein family. A similar protein in yeast is part of a two component methyltransferase, which is involved in the posttranslational modification that produces the modified nucleoside 1-methyladenosine in tRNAs. Modified 1-methyladenosine influences initiator methionine stability and may be involved in the replication of human immunodeficiency virus type 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931414P19Rik T G 14: 54,591,153 N297T probably damaging Het
6820408C15Rik A G 2: 152,441,055 N251S probably benign Het
Abcc5 T C 16: 20,333,630 T1389A probably damaging Het
Acad11 A G 9: 104,081,327 T265A probably benign Het
Ace3 C T 11: 105,997,258 Q302* probably null Het
Aip A T 19: 4,116,066 H128Q probably benign Het
Akr1b7 A T 6: 34,412,334 probably null Het
Arid4a T A 12: 71,017,082 probably null Het
Armh1 T A 4: 117,229,937 H177L probably damaging Het
Aspm A G 1: 139,480,142 T2256A probably benign Het
Bco1 A T 8: 117,113,522 M260L probably benign Het
Ccdc110 A G 8: 45,941,987 N305S probably benign Het
Ccdc158 T A 5: 92,612,486 Y1035F probably damaging Het
Cd180 C T 13: 102,705,429 L328F probably damaging Het
Cntrl T C 2: 35,149,491 L1121P probably damaging Het
Cyp2u1 A C 3: 131,298,010 I287S probably damaging Het
Dnah3 C T 7: 119,971,727 M2195I probably benign Het
Dnajc21 C T 15: 10,447,691 probably null Het
Dock10 C T 1: 80,538,859 V1398M possibly damaging Het
Dpy19l3 T A 7: 35,749,847 I44F possibly damaging Het
Dst C A 1: 34,228,369 T4964K possibly damaging Het
Ercc4 T C 16: 13,123,435 I139T probably damaging Het
Gpr4 T A 7: 19,222,635 F161I probably damaging Het
Gucy2e A C 11: 69,232,001 L516R possibly damaging Het
Hdhd5 A G 6: 120,521,209 V143A probably benign Het
Heatr4 T A 12: 83,979,727 Q252L probably damaging Het
Heatr5a T G 12: 51,955,508 D215A possibly damaging Het
Hipk2 G T 6: 38,818,842 A164D probably damaging Het
Igsf11 A G 16: 39,008,881 I46V probably benign Het
Iqgap1 C T 7: 80,766,884 probably null Het
Lrig1 A G 6: 94,625,029 L281P probably damaging Het
Olfr850 G T 9: 19,477,765 H159N probably benign Het
Olfr9 A G 10: 128,990,322 S137G probably benign Het
Pcdha7 A G 18: 36,975,121 T400A probably damaging Het
Pde5a A G 3: 122,824,924 T629A probably benign Het
Pkhd1l1 A G 15: 44,562,655 D3204G probably damaging Het
Prkd2 T C 7: 16,843,793 F57S probably benign Het
Prr15l T C 11: 96,934,607 V21A probably damaging Het
Rag2 T A 2: 101,630,555 N403K probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Rtl1 C A 12: 109,594,503 D301Y probably damaging Het
Sept14 T C 5: 129,692,987 N215S probably benign Het
Sin3a T A 9: 57,117,540 D1061E probably benign Het
Skint5 T A 4: 113,717,127 probably null Het
Stox2 A T 8: 47,193,101 D441E probably damaging Het
Tmem52b G A 6: 129,516,742 probably null Het
Tpm3-rs7 A G 14: 113,314,860 E62G probably benign Het
Trim54 G T 5: 31,134,080 V182L probably damaging Het
Ttc21b T C 2: 66,226,790 S613G probably benign Het
Ttll4 C A 1: 74,679,349 R120S possibly damaging Het
Wdr41 A T 13: 95,018,174 K354N probably damaging Het
Zfp652 A T 11: 95,749,404 K52* probably null Het
Other mutations in Trmt6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02314:Trmt6 APN 2 132805458 missense probably benign 0.01
IGL02604:Trmt6 APN 2 132810437 nonsense probably null
IGL03216:Trmt6 APN 2 132808698 missense probably null
IGL03231:Trmt6 APN 2 132815836 missense probably benign 0.01
R0060:Trmt6 UTSW 2 132806769 missense possibly damaging 0.84
R0060:Trmt6 UTSW 2 132806769 missense possibly damaging 0.84
R0086:Trmt6 UTSW 2 132809017 critical splice acceptor site probably benign
R0485:Trmt6 UTSW 2 132809030 splice site probably benign
R0827:Trmt6 UTSW 2 132815834 missense probably damaging 1.00
R1654:Trmt6 UTSW 2 132815835 missense possibly damaging 0.92
R1757:Trmt6 UTSW 2 132810237 missense probably damaging 0.96
R1974:Trmt6 UTSW 2 132811048 missense probably damaging 1.00
R2008:Trmt6 UTSW 2 132806909 nonsense probably null
R2310:Trmt6 UTSW 2 132808912 missense probably damaging 1.00
R4989:Trmt6 UTSW 2 132808271 missense possibly damaging 0.58
R5288:Trmt6 UTSW 2 132808783 missense probably benign 0.03
R5385:Trmt6 UTSW 2 132808783 missense probably benign 0.03
R5386:Trmt6 UTSW 2 132808783 missense probably benign 0.03
R6546:Trmt6 UTSW 2 132812153 missense probably benign 0.16
R8016:Trmt6 UTSW 2 132809906 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGGGCCACACAGAAAGATTC -3'
(R):5'- TACTGTCGCCTCAAGTGAAC -3'

Sequencing Primer
(F):5'- CAACTCGATCTGGTTCTCT -3'
(R):5'- TGTCGCCTCAAGTGAACAATAATC -3'
Posted On2018-10-18