Incidental Mutation 'R6815:Prkd2'
ID537276
Institutional Source Beutler Lab
Gene Symbol Prkd2
Ensembl Gene ENSMUSG00000041187
Gene Nameprotein kinase D2
SynonymsPKD2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6815 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location16842902-16870464 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 16843793 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 57 (F57S)
Ref Sequence ENSEMBL: ENSMUSP00000131192 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019220] [ENSMUST00000086104] [ENSMUST00000108495] [ENSMUST00000168093]
Predicted Effect probably benign
Transcript: ENSMUST00000019220
SMART Domains Protein: ENSMUSP00000019220
Gene: ENSMUSG00000030374

DomainStartEndE-ValueType
low complexity region 6 16 N/A INTRINSIC
low complexity region 21 60 N/A INTRINSIC
Pfam:Striatin 64 193 1.2e-44 PFAM
low complexity region 217 236 N/A INTRINSIC
low complexity region 272 284 N/A INTRINSIC
low complexity region 304 314 N/A INTRINSIC
low complexity region 367 382 N/A INTRINSIC
low complexity region 416 429 N/A INTRINSIC
WD40 434 473 5.72e-9 SMART
WD40 487 526 6.53e-4 SMART
WD40 540 579 6.99e-13 SMART
WD40 584 626 2.38e1 SMART
WD40 629 672 3.55e1 SMART
WD40 675 714 5.34e-9 SMART
WD40 717 760 1.58e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000086104
AA Change: F57S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000083273
Gene: ENSMUSG00000041187
AA Change: F57S

DomainStartEndE-ValueType
low complexity region 2 43 N/A INTRINSIC
C1 139 188 2.87e-11 SMART
C1 266 315 1.28e-17 SMART
low complexity region 353 373 N/A INTRINSIC
PH 399 512 2.07e-6 SMART
S_TKc 552 808 6.12e-92 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108495
SMART Domains Protein: ENSMUSP00000104135
Gene: ENSMUSG00000030374

DomainStartEndE-ValueType
low complexity region 6 16 N/A INTRINSIC
low complexity region 21 60 N/A INTRINSIC
Pfam:Striatin 64 197 1.4e-45 PFAM
low complexity region 217 236 N/A INTRINSIC
low complexity region 272 284 N/A INTRINSIC
low complexity region 304 314 N/A INTRINSIC
low complexity region 367 382 N/A INTRINSIC
low complexity region 409 422 N/A INTRINSIC
WD40 427 466 5.72e-9 SMART
WD40 480 519 6.53e-4 SMART
WD40 533 572 6.99e-13 SMART
WD40 577 619 2.38e1 SMART
WD40 622 665 3.55e1 SMART
WD40 668 707 5.34e-9 SMART
WD40 710 753 1.58e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000168093
AA Change: F57S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000131192
Gene: ENSMUSG00000041187
AA Change: F57S

DomainStartEndE-ValueType
low complexity region 2 43 N/A INTRINSIC
C1 139 188 2.87e-11 SMART
C1 266 315 1.28e-17 SMART
low complexity region 353 373 N/A INTRINSIC
PH 399 512 2.07e-6 SMART
S_TKc 552 808 6.12e-92 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000184694
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the protein kinase D (PKD) family of serine/threonine protein kinases. This kinase can be activated by phorbol esters as well as by gastrin via the cholecystokinin B receptor (CCKBR) in gastric cancer cells. It can bind to diacylglycerol (DAG) in the trans-Golgi network (TGN) and may regulate basolateral membrane protein exit from TGN. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit impaired IgM and IgG1 antigen responses and CD4+ and CD8+ T cell production of IL2 and IFN-gamma in response to TCR stimulation. Mice homozygous for a gene trap allele exhibit normal T lymphocyte maturation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931414P19Rik T G 14: 54,591,153 N297T probably damaging Het
6820408C15Rik A G 2: 152,441,055 N251S probably benign Het
Abcc5 T C 16: 20,333,630 T1389A probably damaging Het
Acad11 A G 9: 104,081,327 T265A probably benign Het
Ace3 C T 11: 105,997,258 Q302* probably null Het
Aip A T 19: 4,116,066 H128Q probably benign Het
Akr1b7 A T 6: 34,412,334 probably null Het
Arid4a T A 12: 71,017,082 probably null Het
Armh1 T A 4: 117,229,937 H177L probably damaging Het
Aspm A G 1: 139,480,142 T2256A probably benign Het
Bco1 A T 8: 117,113,522 M260L probably benign Het
Ccdc110 A G 8: 45,941,987 N305S probably benign Het
Ccdc158 T A 5: 92,612,486 Y1035F probably damaging Het
Cd180 C T 13: 102,705,429 L328F probably damaging Het
Cntrl T C 2: 35,149,491 L1121P probably damaging Het
Cyp2u1 A C 3: 131,298,010 I287S probably damaging Het
Dnah3 C T 7: 119,971,727 M2195I probably benign Het
Dnajc21 C T 15: 10,447,691 probably null Het
Dock10 C T 1: 80,538,859 V1398M possibly damaging Het
Dpy19l3 T A 7: 35,749,847 I44F possibly damaging Het
Dst C A 1: 34,228,369 T4964K possibly damaging Het
Ercc4 T C 16: 13,123,435 I139T probably damaging Het
Gpr4 T A 7: 19,222,635 F161I probably damaging Het
Gucy2e A C 11: 69,232,001 L516R possibly damaging Het
Hdhd5 A G 6: 120,521,209 V143A probably benign Het
Heatr4 T A 12: 83,979,727 Q252L probably damaging Het
Heatr5a T G 12: 51,955,508 D215A possibly damaging Het
Hipk2 G T 6: 38,818,842 A164D probably damaging Het
Igsf11 A G 16: 39,008,881 I46V probably benign Het
Iqgap1 C T 7: 80,766,884 probably null Het
Lrig1 A G 6: 94,625,029 L281P probably damaging Het
Olfr850 G T 9: 19,477,765 H159N probably benign Het
Olfr9 A G 10: 128,990,322 S137G probably benign Het
Pcdha7 A G 18: 36,975,121 T400A probably damaging Het
Pde5a A G 3: 122,824,924 T629A probably benign Het
Pkhd1l1 A G 15: 44,562,655 D3204G probably damaging Het
Prr15l T C 11: 96,934,607 V21A probably damaging Het
Rag2 T A 2: 101,630,555 N403K probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Rtl1 C A 12: 109,594,503 D301Y probably damaging Het
Sept14 T C 5: 129,692,987 N215S probably benign Het
Sin3a T A 9: 57,117,540 D1061E probably benign Het
Skint5 T A 4: 113,717,127 probably null Het
Stox2 A T 8: 47,193,101 D441E probably damaging Het
Tmem52b G A 6: 129,516,742 probably null Het
Tpm3-rs7 A G 14: 113,314,860 E62G probably benign Het
Trim54 G T 5: 31,134,080 V182L probably damaging Het
Trmt6 A C 2: 132,809,858 V214G probably damaging Het
Ttc21b T C 2: 66,226,790 S613G probably benign Het
Ttll4 C A 1: 74,679,349 R120S possibly damaging Het
Wdr41 A T 13: 95,018,174 K354N probably damaging Het
Zfp652 A T 11: 95,749,404 K52* probably null Het
Other mutations in Prkd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Prkd2 APN 7 16865862 missense probably damaging 1.00
IGL01138:Prkd2 APN 7 16848811 missense probably damaging 1.00
IGL01714:Prkd2 APN 7 16863942 missense probably damaging 1.00
IGL01968:Prkd2 APN 7 16869576 splice site probably null
IGL01969:Prkd2 APN 7 16865757 missense probably damaging 1.00
IGL02354:Prkd2 APN 7 16847658 missense probably damaging 1.00
IGL02361:Prkd2 APN 7 16847658 missense probably damaging 1.00
IGL02504:Prkd2 APN 7 16857832 missense probably damaging 1.00
IGL02804:Prkd2 APN 7 16855890 missense probably benign 0.04
IGL02834:Prkd2 APN 7 16845934 missense probably damaging 0.97
IGL02962:Prkd2 APN 7 16869832 missense probably benign 0.01
IGL03053:Prkd2 APN 7 16850263 missense possibly damaging 0.63
IGL03168:Prkd2 APN 7 16850263 missense possibly damaging 0.63
alila UTSW 7 16847654 missense probably damaging 1.00
Beaches UTSW 7 16849203 nonsense probably null
Purnama UTSW 7 16869565 missense probably damaging 1.00
Sandals UTSW 7 16865714 missense probably damaging 1.00
R0024:Prkd2 UTSW 7 16847643 missense probably damaging 1.00
R0173:Prkd2 UTSW 7 16849044 missense probably benign
R0190:Prkd2 UTSW 7 16869890 missense probably damaging 1.00
R0834:Prkd2 UTSW 7 16865677 splice site probably benign
R1418:Prkd2 UTSW 7 16869545 missense probably benign 0.03
R1488:Prkd2 UTSW 7 16858439 missense probably damaging 1.00
R1648:Prkd2 UTSW 7 16857807 missense possibly damaging 0.51
R2015:Prkd2 UTSW 7 16847677 nonsense probably null
R2042:Prkd2 UTSW 7 16856268 missense possibly damaging 0.86
R2101:Prkd2 UTSW 7 16869565 missense probably damaging 1.00
R3884:Prkd2 UTSW 7 16853255 missense probably benign 0.02
R4601:Prkd2 UTSW 7 16843648 unclassified probably benign
R4979:Prkd2 UTSW 7 16848727 missense probably damaging 1.00
R5240:Prkd2 UTSW 7 16855786 missense probably benign 0.09
R5643:Prkd2 UTSW 7 16843792 missense probably benign 0.02
R5994:Prkd2 UTSW 7 16850336 missense probably benign 0.00
R6033:Prkd2 UTSW 7 16865714 missense probably damaging 1.00
R6033:Prkd2 UTSW 7 16865714 missense probably damaging 1.00
R6361:Prkd2 UTSW 7 16847654 missense probably damaging 1.00
R6738:Prkd2 UTSW 7 16865905 missense possibly damaging 0.64
R6798:Prkd2 UTSW 7 16849203 nonsense probably null
R7241:Prkd2 UTSW 7 16857805 missense probably benign 0.44
R7293:Prkd2 UTSW 7 16845940 missense possibly damaging 0.88
R7323:Prkd2 UTSW 7 16847622 missense probably benign 0.07
R7900:Prkd2 UTSW 7 16853344 missense probably benign 0.01
R7983:Prkd2 UTSW 7 16853344 missense probably benign 0.01
X0062:Prkd2 UTSW 7 16855791 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- AGAGCTCTCGGATCTAGGTC -3'
(R):5'- ACACGACTAGGGTGTAGTGC -3'

Sequencing Primer
(F):5'- ATCTAGGTCCCAGGGTCCTTG -3'
(R):5'- GTGTAGTGCCCCTCCTCG -3'
Posted On2018-10-18