Incidental Mutation 'R6815:Olfr9'
ID537288
Institutional Source Beutler Lab
Gene Symbol Olfr9
Ensembl Gene ENSMUSG00000069430
Gene Nameolfactory receptor 9
SynonymsMOR269-3, GA_x6K02T2PULF-10675610-10676548
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R6815 (G1)
Quality Score225.009
Status Not validated
Chromosome10
Chromosomal Location128989431-128992102 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 128990322 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 137 (S137G)
Ref Sequence ENSEMBL: ENSMUSP00000089622 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091996]
Predicted Effect probably benign
Transcript: ENSMUST00000091996
AA Change: S137G

PolyPhen 2 Score 0.170 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000089622
Gene: ENSMUSG00000069430
AA Change: S137G

DomainStartEndE-ValueType
Pfam:7tm_4 31 307 2.6e-48 PFAM
Pfam:7TM_GPCR_Srsx 35 305 6.9e-10 PFAM
Pfam:7tm_1 41 290 7.3e-15 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931414P19Rik T G 14: 54,591,153 N297T probably damaging Het
6820408C15Rik A G 2: 152,441,055 N251S probably benign Het
Abcc5 T C 16: 20,333,630 T1389A probably damaging Het
Acad11 A G 9: 104,081,327 T265A probably benign Het
Ace3 C T 11: 105,997,258 Q302* probably null Het
Aip A T 19: 4,116,066 H128Q probably benign Het
Akr1b7 A T 6: 34,412,334 probably null Het
Arid4a T A 12: 71,017,082 probably null Het
Armh1 T A 4: 117,229,937 H177L probably damaging Het
Aspm A G 1: 139,480,142 T2256A probably benign Het
Bco1 A T 8: 117,113,522 M260L probably benign Het
Ccdc110 A G 8: 45,941,987 N305S probably benign Het
Ccdc158 T A 5: 92,612,486 Y1035F probably damaging Het
Cd180 C T 13: 102,705,429 L328F probably damaging Het
Cntrl T C 2: 35,149,491 L1121P probably damaging Het
Cyp2u1 A C 3: 131,298,010 I287S probably damaging Het
Dnah3 C T 7: 119,971,727 M2195I probably benign Het
Dnajc21 C T 15: 10,447,691 probably null Het
Dock10 C T 1: 80,538,859 V1398M possibly damaging Het
Dpy19l3 T A 7: 35,749,847 I44F possibly damaging Het
Dst C A 1: 34,228,369 T4964K possibly damaging Het
Ercc4 T C 16: 13,123,435 I139T probably damaging Het
Gpr4 T A 7: 19,222,635 F161I probably damaging Het
Gucy2e A C 11: 69,232,001 L516R possibly damaging Het
Hdhd5 A G 6: 120,521,209 V143A probably benign Het
Heatr4 T A 12: 83,979,727 Q252L probably damaging Het
Heatr5a T G 12: 51,955,508 D215A possibly damaging Het
Hipk2 G T 6: 38,818,842 A164D probably damaging Het
Igsf11 A G 16: 39,008,881 I46V probably benign Het
Iqgap1 C T 7: 80,766,884 probably null Het
Lrig1 A G 6: 94,625,029 L281P probably damaging Het
Olfr850 G T 9: 19,477,765 H159N probably benign Het
Pcdha7 A G 18: 36,975,121 T400A probably damaging Het
Pde5a A G 3: 122,824,924 T629A probably benign Het
Pkhd1l1 A G 15: 44,562,655 D3204G probably damaging Het
Prkd2 T C 7: 16,843,793 F57S probably benign Het
Prr15l T C 11: 96,934,607 V21A probably damaging Het
Rag2 T A 2: 101,630,555 N403K probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Rtl1 C A 12: 109,594,503 D301Y probably damaging Het
Sept14 T C 5: 129,692,987 N215S probably benign Het
Sin3a T A 9: 57,117,540 D1061E probably benign Het
Skint5 T A 4: 113,717,127 probably null Het
Stox2 A T 8: 47,193,101 D441E probably damaging Het
Tmem52b G A 6: 129,516,742 probably null Het
Tpm3-rs7 A G 14: 113,314,860 E62G probably benign Het
Trim54 G T 5: 31,134,080 V182L probably damaging Het
Trmt6 A C 2: 132,809,858 V214G probably damaging Het
Ttc21b T C 2: 66,226,790 S613G probably benign Het
Ttll4 C A 1: 74,679,349 R120S possibly damaging Het
Wdr41 A T 13: 95,018,174 K354N probably damaging Het
Zfp652 A T 11: 95,749,404 K52* probably null Het
Other mutations in Olfr9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02034:Olfr9 APN 10 128990701 missense probably benign 0.19
IGL02934:Olfr9 APN 10 128990089 missense probably damaging 1.00
R0180:Olfr9 UTSW 10 128990834 missense possibly damaging 0.87
R1716:Olfr9 UTSW 10 128990852 makesense probably null
R5066:Olfr9 UTSW 10 128990791 missense probably damaging 1.00
R5337:Olfr9 UTSW 10 128990679 missense probably benign 0.03
R5980:Olfr9 UTSW 10 128990440 missense probably damaging 0.98
R6924:Olfr9 UTSW 10 128990091 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGTGGTGGAGATCCTCTAC -3'
(R):5'- AAGAGGTTCCCCACTTCACC -3'

Sequencing Primer
(F):5'- ACCATTGTGCCTCGGATG -3'
(R):5'- CCCCAGAAAGTGCTTGCAGTAG -3'
Posted On2018-10-18