Mutagenetix > Incidental Mutations

Incidental Mutation 'R6815:Cd180'

537298

Institutional Source

Beutler Lab

Gene Symbol

Cd180

Ensembl Gene

ENSMUSG00000021624

Gene Name

CD180 antigen

Synonyms

Ly78, RP105

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6815 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

102693558-102739629 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 102705429 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Phenylalanine at position 328 (L328F)

Ref Sequence

ENSEMBL: ENSMUSP00000022124 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022124] [ENSMUST00000167144] [ENSMUST00000170878] [ENSMUST00000171267] [ENSMUST00000172138]

PDB Structure

Crystal structure of mouse RP105/MD-1 complex [X-RAY DIFFRACTION]

Predicted Effect

probably damaging
Transcript: ENSMUST00000022124
AA Change: L328F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000022124
Gene: ENSMUSG00000021624
AA Change: L328F

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
LRR	76	99	1.07e0	SMART
LRR	193	221	1.76e2	SMART
LRR	297	320	1.66e1	SMART
Pfam:LRR_8	321	382	4.2e-13	PFAM
LRR	395	418	3e1	SMART
LRR	444	467	3.09e1	SMART
LRR	495	518	4.97e0	SMART
LRR	519	542	2.4e1	SMART
low complexity region	555	567	N/A	INTRINSIC
LRRCT	577	626	5.11e-8	SMART
transmembrane domain	628	650	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000167144

SMART Domains

Protein: ENSMUSP00000133015
Gene: ENSMUSG00000021624

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000170878

SMART Domains

Protein: ENSMUSP00000127880
Gene: ENSMUSG00000021624

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
PDB:3T6Q\|B	21	86	3e-38	PDB
SCOP:d1m0za_	35	84	4e-4	SMART
Blast:LRR	51	75	1e-5	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000171267

SMART Domains

Protein: ENSMUSP00000129096
Gene: ENSMUSG00000021624

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
PDB:3T6Q\|B	21	86	2e-38	PDB
SCOP:d1m0za_	35	84	9e-4	SMART
Blast:LRR	51	75	7e-6	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000172138

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] CD180 is a cell surface molecule consisting of extracellular leucine-rich repeats (LRR) and a short cytoplasmic tail. The extracellular LRR is associated with a molecule called MD-1 and form the cell surface receptor complex, RP105/MD-1. It belongs to the family of pathogen receptors, Toll-like receptors (TLR). RP105/MD1, by working in concert with TLR4, controls B cell recognition and signaling of lipopolysaccharide (LPS), a membrane constituent of Gram-negative bacteria. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation showed impaired proliferative and humoral immune responses of B cells to lipopolysaccharides. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931414P19Rik	T	G	14: 54,591,153	N297T	probably damaging	Het
6820408C15Rik	A	G	2: 152,441,055	N251S	probably benign	Het
Abcc5	T	C	16: 20,333,630	T1389A	probably damaging	Het
Acad11	A	G	9: 104,081,327	T265A	probably benign	Het
Ace3	C	T	11: 105,997,258	Q302*	probably null	Het
Aip	A	T	19: 4,116,066	H128Q	probably benign	Het
Akr1b7	A	T	6: 34,412,334		probably null	Het
Arid4a	T	A	12: 71,017,082		probably null	Het
Armh1	T	A	4: 117,229,937	H177L	probably damaging	Het
Aspm	A	G	1: 139,480,142	T2256A	probably benign	Het
Bco1	A	T	8: 117,113,522	M260L	probably benign	Het
Ccdc110	A	G	8: 45,941,987	N305S	probably benign	Het
Ccdc158	T	A	5: 92,612,486	Y1035F	probably damaging	Het
Cntrl	T	C	2: 35,149,491	L1121P	probably damaging	Het
Cyp2u1	A	C	3: 131,298,010	I287S	probably damaging	Het
Dnah3	C	T	7: 119,971,727	M2195I	probably benign	Het
Dnajc21	C	T	15: 10,447,691		probably null	Het
Dock10	C	T	1: 80,538,859	V1398M	possibly damaging	Het
Dpy19l3	T	A	7: 35,749,847	I44F	possibly damaging	Het
Dst	C	A	1: 34,228,369	T4964K	possibly damaging	Het
Ercc4	T	C	16: 13,123,435	I139T	probably damaging	Het
Gpr4	T	A	7: 19,222,635	F161I	probably damaging	Het
Gucy2e	A	C	11: 69,232,001	L516R	possibly damaging	Het
Hdhd5	A	G	6: 120,521,209	V143A	probably benign	Het
Heatr4	T	A	12: 83,979,727	Q252L	probably damaging	Het
Heatr5a	T	G	12: 51,955,508	D215A	possibly damaging	Het
Hipk2	G	T	6: 38,818,842	A164D	probably damaging	Het
Igsf11	A	G	16: 39,008,881	I46V	probably benign	Het
Iqgap1	C	T	7: 80,766,884		probably null	Het
Lrig1	A	G	6: 94,625,029	L281P	probably damaging	Het
Olfr850	G	T	9: 19,477,765	H159N	probably benign	Het
Olfr9	A	G	10: 128,990,322	S137G	probably benign	Het
Pcdha7	A	G	18: 36,975,121	T400A	probably damaging	Het
Pde5a	A	G	3: 122,824,924	T629A	probably benign	Het
Pkhd1l1	A	G	15: 44,562,655	D3204G	probably damaging	Het
Prkd2	T	C	7: 16,843,793	F57S	probably benign	Het
Prr15l	T	C	11: 96,934,607	V21A	probably damaging	Het
Rag2	T	A	2: 101,630,555	N403K	probably damaging	Het
Rsf1	ATGGCG	ATGGCGACGGTGGCG	7: 97,579,904		probably benign	Het
Rtl1	C	A	12: 109,594,503	D301Y	probably damaging	Het
Sept14	T	C	5: 129,692,987	N215S	probably benign	Het
Sin3a	T	A	9: 57,117,540	D1061E	probably benign	Het
Skint5	T	A	4: 113,717,127		probably null	Het
Stox2	A	T	8: 47,193,101	D441E	probably damaging	Het
Tmem52b	G	A	6: 129,516,742		probably null	Het
Tpm3-rs7	A	G	14: 113,314,860	E62G	probably benign	Het
Trim54	G	T	5: 31,134,080	V182L	probably damaging	Het
Trmt6	A	C	2: 132,809,858	V214G	probably damaging	Het
Ttc21b	T	C	2: 66,226,790	S613G	probably benign	Het
Ttll4	C	A	1: 74,679,349	R120S	possibly damaging	Het
Wdr41	A	T	13: 95,018,174	K354N	probably damaging	Het
Zfp652	A	T	11: 95,749,404	K52*	probably null	Het

Other mutations in Cd180

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00778:Cd180	APN	13	102705409	missense	probably benign
IGL00949:Cd180	APN	13	102693760	missense	possibly damaging	0.89
IGL01864:Cd180	APN	13	102706033	missense	possibly damaging	0.93
IGL01901:Cd180	APN	13	102706428	missense	probably benign	0.04
IGL01934:Cd180	APN	13	102702858	missense	probably damaging	1.00
IGL01998:Cd180	APN	13	102705214	missense	probably damaging	0.99
IGL02336:Cd180	APN	13	102705313	missense	probably damaging	0.98
IGL03031:Cd180	APN	13	102705027	missense	probably benign	0.00
IGL03139:Cd180	APN	13	102706416	missense	probably damaging	1.00
Volte_face	UTSW	13	102704923	missense	probably damaging	0.99
H8562:Cd180	UTSW	13	102705418	missense	probably benign	0.02
R0004:Cd180	UTSW	13	102702708	missense	probably benign	0.00
R0393:Cd180	UTSW	13	102705900	missense	probably damaging	0.99
R0565:Cd180	UTSW	13	102702874	intron	probably benign
R1080:Cd180	UTSW	13	102706220	nonsense	probably null
R1223:Cd180	UTSW	13	102706222	missense	possibly damaging	0.49
R1669:Cd180	UTSW	13	102705490	missense	probably damaging	1.00
R1772:Cd180	UTSW	13	102706242	missense	probably benign	0.11
R1784:Cd180	UTSW	13	102705859	missense	probably damaging	1.00
R1865:Cd180	UTSW	13	102706009	missense	probably benign
R2252:Cd180	UTSW	13	102706398	nonsense	probably null
R2385:Cd180	UTSW	13	102705183	missense	probably benign	0.00
R4653:Cd180	UTSW	13	102704908	missense	probably damaging	1.00
R4695:Cd180	UTSW	13	102705760	missense	probably benign	0.01
R4790:Cd180	UTSW	13	102702822	missense	probably damaging	0.98
R4934:Cd180	UTSW	13	102739164	critical splice acceptor site	probably null
R5052:Cd180	UTSW	13	102704895	missense	probably benign
R5154:Cd180	UTSW	13	102705774	missense	probably damaging	1.00
R5469:Cd180	UTSW	13	102704834	missense	probably benign	0.37
R5493:Cd180	UTSW	13	102706141	missense	probably benign	0.07
R5615:Cd180	UTSW	13	102706203	missense	probably benign	0.34
R5905:Cd180	UTSW	13	102706033	missense	possibly damaging	0.93
R6282:Cd180	UTSW	13	102693757	missense	possibly damaging	0.90
R6433:Cd180	UTSW	13	102705633	missense	probably benign	0.00
R6456:Cd180	UTSW	13	102702836	missense	probably damaging	1.00
R6784:Cd180	UTSW	13	102702705	missense	probably damaging	0.97
R6838:Cd180	UTSW	13	102702731	missense	probably benign	0.38
R6941:Cd180	UTSW	13	102706191	missense	probably benign	0.23
R7048:Cd180	UTSW	13	102704923	missense	probably damaging	0.99
R7338:Cd180	UTSW	13	102706428	missense	probably benign	0.04
R7466:Cd180	UTSW	13	102704995	missense	probably damaging	1.00
R7647:Cd180	UTSW	13	102705943	missense	probably damaging	1.00
R8179:Cd180	UTSW	13	102705633	missense	probably benign	0.00
R8252:Cd180	UTSW	13	102705996	missense	probably benign	0.00
R8300:Cd180	UTSW	13	102704793	missense	probably benign	0.01
R8460:Cd180	UTSW	13	102702846	missense	probably damaging	1.00
Z1176:Cd180	UTSW	13	102705766	missense	probably damaging	1.00
Z1177:Cd180	UTSW	13	102706032	missense	possibly damaging	0.95

Predicted Primers

PCR Primer
(F):5'- CTGTGAAATGTCTGTGGAGAGC -3'
(R):5'- GCTCAAGTTCAGGCTCTGTAAG -3'

Sequencing Primer
(F):5'- TGTCTGTGGAGAGCATCAACCTAC -3'
(R):5'- TCAAGTTCAGGCTCTGTAAGTGAGAC -3'

Posted On

2018-10-18