Incidental Mutation 'R6816:Syt2'
ID537311
Institutional Source Beutler Lab
Gene Symbol Syt2
Ensembl Gene ENSMUSG00000026452
Gene Namesynaptotagmin II
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.104) question?
Stock #R6816 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location134646677-134762593 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 134745800 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 294 (I294N)
Ref Sequence ENSEMBL: ENSMUSP00000140081 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000121990] [ENSMUST00000187725] [ENSMUST00000188842]
Predicted Effect probably damaging
Transcript: ENSMUST00000121990
AA Change: I294N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112438
Gene: ENSMUSG00000026452
AA Change: I294N

DomainStartEndE-ValueType
PDB:4KBB|D 5 63 7e-16 PDB
transmembrane domain 65 87 N/A INTRINSIC
low complexity region 124 145 N/A INTRINSIC
C2 158 260 7.21e-22 SMART
C2 289 403 1.86e-24 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000187725
SMART Domains Protein: ENSMUSP00000141156
Gene: ENSMUSG00000026452

DomainStartEndE-ValueType
PDB:4KBB|D 5 63 5e-18 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000188842
AA Change: I294N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000140081
Gene: ENSMUSG00000026452
AA Change: I294N

DomainStartEndE-ValueType
PDB:4KBB|D 5 63 7e-16 PDB
transmembrane domain 65 87 N/A INTRINSIC
low complexity region 124 145 N/A INTRINSIC
C2 158 260 7.21e-22 SMART
C2 289 403 1.86e-24 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 96% (49/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a synaptic vesicle membrane protein. The encoded protein is thought to function as a calcium sensor in vesicular trafficking and exocytosis. Mutations in this gene are associated with myasthenic syndrome, presynaptic, congenital, with or without motor neuropathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for an ENU-induced allele are viable but sterile, weigh less and show ataxia and altered spontaneous and Ca2+-evoked neurotransmitter release. Mice homozygous for a null allele die at weaning showing growth arrest, motor dysfunction and impaired Ca2+-evoked neurotransmitter release. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg5 A G 8: 94,941,683 T458A probably damaging Het
Ankrd36 T G 11: 5,643,765 F457V possibly damaging Het
Cep152 T C 2: 125,595,027 E531G probably damaging Het
Dpf1 A C 7: 29,311,662 D162A possibly damaging Het
E2f8 A T 7: 48,875,583 Y214N possibly damaging Het
Fer1l5 A T 1: 36,406,510 Y786F possibly damaging Het
Fhod1 G T 8: 105,330,544 Q933K probably benign Het
Gdap2 T C 3: 100,191,705 probably null Het
Gm6205 A T 5: 94,683,914 Q260L possibly damaging Het
Gm996 C CTCTA 2: 25,579,721 probably null Het
Grin2d A G 7: 45,833,682 probably benign Het
Hgs T A 11: 120,471,571 V112D probably damaging Het
Hist1h2bp C T 13: 21,787,777 S88L probably benign Het
Igf2r A T 17: 12,714,082 V851E probably damaging Het
Igfn1 T A 1: 135,959,728 T2533S probably benign Het
Iqch C T 9: 63,480,759 V750I probably benign Het
Itih2 A G 2: 10,105,706 Y525H probably damaging Het
Kcnu1 C T 8: 25,937,734 Q360* probably null Het
Klk1b26 A G 7: 44,016,868 N245S probably benign Het
Kmt2c T C 5: 25,405,532 probably null Het
Lhpp T C 7: 132,634,033 S116P probably benign Het
Madcam1 A G 10: 79,665,440 D113G probably damaging Het
Magi3 A T 3: 104,089,911 probably null Het
Map3k9 A G 12: 81,722,254 S1007P possibly damaging Het
Mkrn2 C T 6: 115,611,728 P144L probably damaging Het
Mon1a T C 9: 107,900,410 S171P probably damaging Het
Nrarp T C 2: 25,181,307 L66P probably damaging Het
P2ry1 T A 3: 61,003,832 F131I probably benign Het
Pdzk1 A G 3: 96,854,570 Q166R probably benign Het
Pigt G T 2: 164,501,132 V249F probably damaging Het
Ppp1r16b G T 2: 158,761,675 V407L probably benign Het
Rab6a G T 7: 100,629,873 E73D probably damaging Het
Ralb C A 1: 119,477,982 G33* probably null Het
Sema3b T A 9: 107,600,350 M491L probably benign Het
Sema3c A C 5: 17,670,465 D40A probably benign Het
Slc22a1 T C 17: 12,652,483 N464D possibly damaging Het
Spire2 T A 8: 123,359,413 S295T probably benign Het
Stat3 T G 11: 100,911,267 Q32P probably damaging Het
Sulf2 T C 2: 166,082,754 T471A probably benign Het
Sult2b1 A G 7: 45,733,678 W227R probably damaging Het
Taar8b A T 10: 24,092,181 F38L probably benign Het
Tbl2 T A 5: 135,159,215 probably null Het
Tex48 G A 4: 63,611,955 S9L probably damaging Het
Tmprss2 A T 16: 97,568,467 M369K possibly damaging Het
Trip12 A T 1: 84,793,714 S280T probably damaging Het
Tspoap1 T C 11: 87,765,665 V263A probably benign Het
Vmn2r74 T A 7: 85,961,413 R24* probably null Het
Wdr35 G A 12: 9,027,724 probably null Het
Zfp202 A G 9: 40,211,813 R624G probably damaging Het
Other mutations in Syt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02385:Syt2 APN 1 134745815 missense probably benign 0.07
IGL02476:Syt2 APN 1 134747631 missense probably benign 0.01
IGL02487:Syt2 APN 1 134740865 missense probably damaging 0.99
IGL02524:Syt2 APN 1 134741965 missense probably benign
IGL02611:Syt2 APN 1 134741882 missense possibly damaging 0.90
IGL03173:Syt2 APN 1 134743579 missense possibly damaging 0.81
IGL03303:Syt2 APN 1 134741911 missense probably benign 0.44
kringle UTSW 1 134747620 missense probably damaging 1.00
R1661:Syt2 UTSW 1 134747620 missense probably damaging 1.00
R1665:Syt2 UTSW 1 134747620 missense probably damaging 1.00
R2049:Syt2 UTSW 1 134746741 splice site probably benign
R2130:Syt2 UTSW 1 134746741 splice site probably benign
R2141:Syt2 UTSW 1 134746741 splice site probably benign
R3154:Syt2 UTSW 1 134741861 missense possibly damaging 0.95
R5392:Syt2 UTSW 1 134744021 missense probably damaging 1.00
R5431:Syt2 UTSW 1 134740957 missense probably benign 0.03
R6065:Syt2 UTSW 1 134747557 missense probably benign 0.00
R6381:Syt2 UTSW 1 134746850 missense probably damaging 1.00
R6923:Syt2 UTSW 1 134746763 missense possibly damaging 0.76
R7002:Syt2 UTSW 1 134744104 missense probably damaging 1.00
R7973:Syt2 UTSW 1 134740832 splice site probably null
R7994:Syt2 UTSW 1 134747592 missense possibly damaging 0.75
R8410:Syt2 UTSW 1 134746864 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- TGTTGGAAGCTGGAGACCAC -3'
(R):5'- CTCAGATATGGACAGGCAGGTG -3'

Sequencing Primer
(F):5'- ACCTCTGCTACAGACATGGGAG -3'
(R):5'- GGTTCTGCATCACCTGAAA -3'
Posted On2018-10-18