Incidental Mutation 'R6816:Tbl2'
ID537327
Institutional Source Beutler Lab
Gene Symbol Tbl2
Ensembl Gene ENSMUSG00000005374
Gene Nametransducin (beta)-like 2
SynonymsC76179, WS-bTRP
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #R6816 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location135149657-135165760 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) T to A at 135159215 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000115011 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005508] [ENSMUST00000139565] [ENSMUST00000152013] [ENSMUST00000153183] [ENSMUST00000153183] [ENSMUST00000153183] [ENSMUST00000153183] [ENSMUST00000201780]
Predicted Effect probably benign
Transcript: ENSMUST00000005508
SMART Domains Protein: ENSMUSP00000005508
Gene: ENSMUSG00000005374

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
low complexity region 50 59 N/A INTRINSIC
WD40 75 114 1.89e-9 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000139565
SMART Domains Protein: ENSMUSP00000120685
Gene: ENSMUSG00000005374

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152013
SMART Domains Protein: ENSMUSP00000118691
Gene: ENSMUSG00000005374

DomainStartEndE-ValueType
low complexity region 15 24 N/A INTRINSIC
WD40 40 79 1.89e-9 SMART
Blast:WD40 87 126 3e-15 BLAST
WD40 138 177 1.67e-1 SMART
Predicted Effect probably null
Transcript: ENSMUST00000153183
SMART Domains Protein: ENSMUSP00000115011
Gene: ENSMUSG00000005374

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
low complexity region 50 59 N/A INTRINSIC
WD40 75 114 1.89e-9 SMART
Blast:WD40 122 161 5e-14 BLAST
WD40 173 212 1.67e-1 SMART
WD40 214 253 2.38e1 SMART
WD40 264 303 6.04e-8 SMART
Blast:WD40 313 353 4e-16 BLAST
WD40 358 395 1.28e0 SMART
coiled coil region 411 442 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000153183
SMART Domains Protein: ENSMUSP00000115011
Gene: ENSMUSG00000005374

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
low complexity region 50 59 N/A INTRINSIC
WD40 75 114 1.89e-9 SMART
Blast:WD40 122 161 5e-14 BLAST
WD40 173 212 1.67e-1 SMART
WD40 214 253 2.38e1 SMART
WD40 264 303 6.04e-8 SMART
Blast:WD40 313 353 4e-16 BLAST
WD40 358 395 1.28e0 SMART
coiled coil region 411 442 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000153183
SMART Domains Protein: ENSMUSP00000115011
Gene: ENSMUSG00000005374

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
low complexity region 50 59 N/A INTRINSIC
WD40 75 114 1.89e-9 SMART
Blast:WD40 122 161 5e-14 BLAST
WD40 173 212 1.67e-1 SMART
WD40 214 253 2.38e1 SMART
WD40 264 303 6.04e-8 SMART
Blast:WD40 313 353 4e-16 BLAST
WD40 358 395 1.28e0 SMART
coiled coil region 411 442 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000153183
SMART Domains Protein: ENSMUSP00000115011
Gene: ENSMUSG00000005374

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
low complexity region 50 59 N/A INTRINSIC
WD40 75 114 1.89e-9 SMART
Blast:WD40 122 161 5e-14 BLAST
WD40 173 212 1.67e-1 SMART
WD40 214 253 2.38e1 SMART
WD40 264 303 6.04e-8 SMART
Blast:WD40 313 353 4e-16 BLAST
WD40 358 395 1.28e0 SMART
coiled coil region 411 442 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000201780
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 96% (49/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the beta-transducin protein family. Most proteins of the beta-transducin family are involved in regulatory functions. This protein is possibly involved in some intracellular signaling pathway. This gene is deleted in Williams-Beuren syndrome, a developmental disorder caused by deletion of multiple genes at 7q11.23. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg5 A G 8: 94,941,683 T458A probably damaging Het
Ankrd36 T G 11: 5,643,765 F457V possibly damaging Het
Cep152 T C 2: 125,595,027 E531G probably damaging Het
Dpf1 A C 7: 29,311,662 D162A possibly damaging Het
E2f8 A T 7: 48,875,583 Y214N possibly damaging Het
Fer1l5 A T 1: 36,406,510 Y786F possibly damaging Het
Fhod1 G T 8: 105,330,544 Q933K probably benign Het
Gdap2 T C 3: 100,191,705 probably null Het
Gm6205 A T 5: 94,683,914 Q260L possibly damaging Het
Gm996 C CTCTA 2: 25,579,721 probably null Het
Grin2d A G 7: 45,833,682 probably benign Het
Hgs T A 11: 120,471,571 V112D probably damaging Het
Hist1h2bp C T 13: 21,787,777 S88L probably benign Het
Igf2r A T 17: 12,714,082 V851E probably damaging Het
Igfn1 T A 1: 135,959,728 T2533S probably benign Het
Iqch C T 9: 63,480,759 V750I probably benign Het
Itih2 A G 2: 10,105,706 Y525H probably damaging Het
Kcnu1 C T 8: 25,937,734 Q360* probably null Het
Klk1b26 A G 7: 44,016,868 N245S probably benign Het
Kmt2c T C 5: 25,405,532 probably null Het
Lhpp T C 7: 132,634,033 S116P probably benign Het
Madcam1 A G 10: 79,665,440 D113G probably damaging Het
Magi3 A T 3: 104,089,911 probably null Het
Map3k9 A G 12: 81,722,254 S1007P possibly damaging Het
Mkrn2 C T 6: 115,611,728 P144L probably damaging Het
Mon1a T C 9: 107,900,410 S171P probably damaging Het
Nrarp T C 2: 25,181,307 L66P probably damaging Het
P2ry1 T A 3: 61,003,832 F131I probably benign Het
Pdzk1 A G 3: 96,854,570 Q166R probably benign Het
Pigt G T 2: 164,501,132 V249F probably damaging Het
Ppp1r16b G T 2: 158,761,675 V407L probably benign Het
Rab6a G T 7: 100,629,873 E73D probably damaging Het
Ralb C A 1: 119,477,982 G33* probably null Het
Sema3b T A 9: 107,600,350 M491L probably benign Het
Sema3c A C 5: 17,670,465 D40A probably benign Het
Slc22a1 T C 17: 12,652,483 N464D possibly damaging Het
Spire2 T A 8: 123,359,413 S295T probably benign Het
Stat3 T G 11: 100,911,267 Q32P probably damaging Het
Sulf2 T C 2: 166,082,754 T471A probably benign Het
Sult2b1 A G 7: 45,733,678 W227R probably damaging Het
Syt2 T A 1: 134,745,800 I294N probably damaging Het
Taar8b A T 10: 24,092,181 F38L probably benign Het
Tex48 G A 4: 63,611,955 S9L probably damaging Het
Tmprss2 A T 16: 97,568,467 M369K possibly damaging Het
Trip12 A T 1: 84,793,714 S280T probably damaging Het
Tspoap1 T C 11: 87,765,665 V263A probably benign Het
Vmn2r74 T A 7: 85,961,413 R24* probably null Het
Wdr35 G A 12: 9,027,724 probably null Het
Zfp202 A G 9: 40,211,813 R624G probably damaging Het
Other mutations in Tbl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01390:Tbl2 APN 5 135156363 unclassified probably benign
IGL02669:Tbl2 APN 5 135152998 missense probably damaging 1.00
R1160:Tbl2 UTSW 5 135159392 missense probably benign 0.01
R1909:Tbl2 UTSW 5 135152991 missense probably damaging 1.00
R1945:Tbl2 UTSW 5 135157600 missense possibly damaging 0.56
R2156:Tbl2 UTSW 5 135156520 critical splice donor site probably null
R2342:Tbl2 UTSW 5 135158753 missense possibly damaging 0.81
R2392:Tbl2 UTSW 5 135156514 missense probably benign 0.10
R3813:Tbl2 UTSW 5 135156521 critical splice donor site probably null
R5560:Tbl2 UTSW 5 135157591 nonsense probably null
R6301:Tbl2 UTSW 5 135159369 missense probably benign
R6723:Tbl2 UTSW 5 135159276 missense probably damaging 1.00
R7136:Tbl2 UTSW 5 135149828 missense probably benign 0.23
R7288:Tbl2 UTSW 5 135154399 missense possibly damaging 0.92
R7720:Tbl2 UTSW 5 135159475 missense probably damaging 1.00
X0024:Tbl2 UTSW 5 135159591 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- AGCAGTGAGTCTGGGGTACTTC -3'
(R):5'- GCCAGTGATGTCAAAAGTCAAG -3'

Sequencing Primer
(F):5'- CTGGGGTACTTCTGCCTGTC -3'
(R):5'- CCAGTGATGTCAAAAGTCAAGTCAGC -3'
Posted On2018-10-18