Incidental Mutation 'R6816:Klk1b26'
ID537330
Institutional Source Beutler Lab
Gene Symbol Klk1b26
Ensembl Gene ENSMUSG00000053719
Gene Namekallikrein 1-related petidase b26
SynonymsEGF-BP type B, Egfbp2, PRECE-2, Klk26, mGK-26
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock #R6816 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location44012168-44016968 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 44016868 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 245 (N245S)
Ref Sequence ENSEMBL: ENSMUSP00000047488 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048945]
Predicted Effect probably benign
Transcript: ENSMUST00000048945
AA Change: N245S

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000047488
Gene: ENSMUSG00000053719
AA Change: N245S

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
Tryp_SPc 24 253 2.29e-92 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 96% (49/51)
MGI Phenotype FUNCTION: This gene encodes a member of the kallikrein subfamily of the peptidase S1 family of serine proteases. The kallikrein genes are present in a large gene cluster on chromosome 7. The encoded preproprotein is proteolytically processed to generate a mature protein product. Expression of this gene in the submandibular gland is sexually dimorphic likely due to both transcriptional and post-transcriptional regulation. This gene is thought to be distinct from the Egfbp2 gene (Gene ID: 13647), with which it shares 98% identity (PMIDs: 1959648, 9685728), however, it is not clear if both genes are present in all strains of mice. [provided by RefSeq, Sep 2015]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg5 A G 8: 94,941,683 T458A probably damaging Het
Ankrd36 T G 11: 5,643,765 F457V possibly damaging Het
Cep152 T C 2: 125,595,027 E531G probably damaging Het
Dpf1 A C 7: 29,311,662 D162A possibly damaging Het
E2f8 A T 7: 48,875,583 Y214N possibly damaging Het
Fer1l5 A T 1: 36,406,510 Y786F possibly damaging Het
Fhod1 G T 8: 105,330,544 Q933K probably benign Het
Gdap2 T C 3: 100,191,705 probably null Het
Gm6205 A T 5: 94,683,914 Q260L possibly damaging Het
Gm996 C CTCTA 2: 25,579,721 probably null Het
Grin2d A G 7: 45,833,682 probably benign Het
Hgs T A 11: 120,471,571 V112D probably damaging Het
Hist1h2bp C T 13: 21,787,777 S88L probably benign Het
Igf2r A T 17: 12,714,082 V851E probably damaging Het
Igfn1 T A 1: 135,959,728 T2533S probably benign Het
Iqch C T 9: 63,480,759 V750I probably benign Het
Itih2 A G 2: 10,105,706 Y525H probably damaging Het
Kcnu1 C T 8: 25,937,734 Q360* probably null Het
Kmt2c T C 5: 25,405,532 probably null Het
Lhpp T C 7: 132,634,033 S116P probably benign Het
Madcam1 A G 10: 79,665,440 D113G probably damaging Het
Magi3 A T 3: 104,089,911 probably null Het
Map3k9 A G 12: 81,722,254 S1007P possibly damaging Het
Mkrn2 C T 6: 115,611,728 P144L probably damaging Het
Mon1a T C 9: 107,900,410 S171P probably damaging Het
Nrarp T C 2: 25,181,307 L66P probably damaging Het
P2ry1 T A 3: 61,003,832 F131I probably benign Het
Pdzk1 A G 3: 96,854,570 Q166R probably benign Het
Pigt G T 2: 164,501,132 V249F probably damaging Het
Ppp1r16b G T 2: 158,761,675 V407L probably benign Het
Rab6a G T 7: 100,629,873 E73D probably damaging Het
Ralb C A 1: 119,477,982 G33* probably null Het
Sema3b T A 9: 107,600,350 M491L probably benign Het
Sema3c A C 5: 17,670,465 D40A probably benign Het
Slc22a1 T C 17: 12,652,483 N464D possibly damaging Het
Spire2 T A 8: 123,359,413 S295T probably benign Het
Stat3 T G 11: 100,911,267 Q32P probably damaging Het
Sulf2 T C 2: 166,082,754 T471A probably benign Het
Sult2b1 A G 7: 45,733,678 W227R probably damaging Het
Syt2 T A 1: 134,745,800 I294N probably damaging Het
Taar8b A T 10: 24,092,181 F38L probably benign Het
Tbl2 T A 5: 135,159,215 probably null Het
Tex48 G A 4: 63,611,955 S9L probably damaging Het
Tmprss2 A T 16: 97,568,467 M369K possibly damaging Het
Trip12 A T 1: 84,793,714 S280T probably damaging Het
Tspoap1 T C 11: 87,765,665 V263A probably benign Het
Vmn2r74 T A 7: 85,961,413 R24* probably null Het
Wdr35 G A 12: 9,027,724 probably null Het
Zfp202 A G 9: 40,211,813 R624G probably damaging Het
Other mutations in Klk1b26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00578:Klk1b26 APN 7 44016885 missense probably benign 0.00
IGL02179:Klk1b26 APN 7 44016312 missense probably benign
IGL03190:Klk1b26 APN 7 44012727 missense possibly damaging 0.76
R0391:Klk1b26 UTSW 7 44012727 missense probably damaging 1.00
R0483:Klk1b26 UTSW 7 44016348 missense probably benign 0.15
R1499:Klk1b26 UTSW 7 44016386 missense probably benign 0.22
R1549:Klk1b26 UTSW 7 44016402 splice site probably benign
R1991:Klk1b26 UTSW 7 44016900 missense probably damaging 0.99
R2103:Klk1b26 UTSW 7 44016900 missense probably damaging 0.99
R2998:Klk1b26 UTSW 7 44016798 missense probably benign 0.26
R3414:Klk1b26 UTSW 7 44016873 missense probably benign
R4990:Klk1b26 UTSW 7 44016249 splice site probably null
R4991:Klk1b26 UTSW 7 44016249 splice site probably null
R5527:Klk1b26 UTSW 7 44012763 missense probably benign 0.00
R5796:Klk1b26 UTSW 7 44016328 missense probably damaging 1.00
R6938:Klk1b26 UTSW 7 44016294 missense probably benign 0.00
R7197:Klk1b26 UTSW 7 44016397 critical splice donor site probably null
R7243:Klk1b26 UTSW 7 44016267 missense not run
R7243:Klk1b26 UTSW 7 44016913 missense probably damaging 1.00
R7253:Klk1b26 UTSW 7 44014789 missense possibly damaging 0.66
R7423:Klk1b26 UTSW 7 44014769 missense probably damaging 0.99
R8270:Klk1b26 UTSW 7 44016120 missense probably benign 0.08
R8342:Klk1b26 UTSW 7 44016084 missense probably damaging 0.98
Z1088:Klk1b26 UTSW 7 44015996 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCTGTATTAATCGCCTTGGGAATC -3'
(R):5'- CATGTACACCTGTCCCTAGC -3'

Sequencing Primer
(F):5'- CAGTTCCAGGTGGTCTACTAGAATC -3'
(R):5'- ACTTTGGAAGTCCTGACCTTAG -3'
Posted On2018-10-18