Mutagenetix > Incidental Mutation

Incidental Mutation 'R6816:Vmn2r74'

537334

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r74

Ensembl Gene

ENSMUSG00000090774

Gene Name

vomeronasal 2, receptor 74

Synonyms

EG546980

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.113) question?

Stock #

R6816 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

85951867-85961482 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

T to A at 85961413 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Stop codon at position 24 (R24*)

Ref Sequence

ENSEMBL: ENSMUSP00000126917 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000166355]

AlphaFold

E9PW21

Predicted Effect

probably null
Transcript: ENSMUST00000166355
AA Change: R24*

SMART Domains

Protein: ENSMUSP00000126917
Gene: ENSMUSG00000090774
AA Change: R24*

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
Pfam:ANF_receptor	77	467	7.3e-28	PFAM
Pfam:NCD3G	510	562	4.7e-20	PFAM
Pfam:7tm_3	592	830	1.3e-52	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.9%

Validation Efficiency

96% (49/51)

Allele List at MGI

Other mutations in this stock

Total: 49 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgrg5	A	G	8: 94,941,683	T458A	probably damaging	Het
Ankrd36	T	G	11: 5,643,765	F457V	possibly damaging	Het
Cep152	T	C	2: 125,595,027	E531G	probably damaging	Het
Dpf1	A	C	7: 29,311,662	D162A	possibly damaging	Het
E2f8	A	T	7: 48,875,583	Y214N	possibly damaging	Het
Fer1l5	A	T	1: 36,406,510	Y786F	possibly damaging	Het
Fhod1	G	T	8: 105,330,544	Q933K	probably benign	Het
Gdap2	T	C	3: 100,191,705		probably null	Het
Gm6205	A	T	5: 94,683,914	Q260L	possibly damaging	Het
Gm996	C	CTCTA	2: 25,579,721		probably null	Het
Grin2d	A	G	7: 45,833,682		probably benign	Het
Hgs	T	A	11: 120,471,571	V112D	probably damaging	Het
Hist1h2bp	C	T	13: 21,787,777	S88L	probably benign	Het
Igf2r	A	T	17: 12,714,082	V851E	probably damaging	Het
Igfn1	T	A	1: 135,959,728	T2533S	probably benign	Het
Iqch	C	T	9: 63,480,759	V750I	probably benign	Het
Itih2	A	G	2: 10,105,706	Y525H	probably damaging	Het
Kcnu1	C	T	8: 25,937,734	Q360*	probably null	Het
Klk1b26	A	G	7: 44,016,868	N245S	probably benign	Het
Kmt2c	T	C	5: 25,405,532		probably null	Het
Lhpp	T	C	7: 132,634,033	S116P	probably benign	Het
Madcam1	A	G	10: 79,665,440	D113G	probably damaging	Het
Magi3	A	T	3: 104,089,911		probably null	Het
Map3k9	A	G	12: 81,722,254	S1007P	possibly damaging	Het
Mkrn2	C	T	6: 115,611,728	P144L	probably damaging	Het
Mon1a	T	C	9: 107,900,410	S171P	probably damaging	Het
Nrarp	T	C	2: 25,181,307	L66P	probably damaging	Het
P2ry1	T	A	3: 61,003,832	F131I	probably benign	Het
Pdzk1	A	G	3: 96,854,570	Q166R	probably benign	Het
Pigt	G	T	2: 164,501,132	V249F	probably damaging	Het
Ppp1r16b	G	T	2: 158,761,675	V407L	probably benign	Het
Rab6a	G	T	7: 100,629,873	E73D	probably damaging	Het
Ralb	C	A	1: 119,477,982	G33*	probably null	Het
Sema3b	T	A	9: 107,600,350	M491L	probably benign	Het
Sema3c	A	C	5: 17,670,465	D40A	probably benign	Het
Slc22a1	T	C	17: 12,652,483	N464D	possibly damaging	Het
Spire2	T	A	8: 123,359,413	S295T	probably benign	Het
Stat3	T	G	11: 100,911,267	Q32P	probably damaging	Het
Sulf2	T	C	2: 166,082,754	T471A	probably benign	Het
Sult2b1	A	G	7: 45,733,678	W227R	probably damaging	Het
Syt2	T	A	1: 134,745,800	I294N	probably damaging	Het
Taar8b	A	T	10: 24,092,181	F38L	probably benign	Het
Tbl2	T	A	5: 135,159,215		probably null	Het
Tex48	G	A	4: 63,611,955	S9L	probably damaging	Het
Tmprss2	A	T	16: 97,568,467	M369K	possibly damaging	Het
Trip12	A	T	1: 84,793,714	S280T	probably damaging	Het
Tspoap1	T	C	11: 87,765,665	V263A	probably benign	Het
Wdr35	G	A	12: 9,027,724		probably null	Het
Zfp202	A	G	9: 40,211,813	R624G	probably damaging	Het

Other mutations in Vmn2r74

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00899:Vmn2r74	APN	7	85957130	missense	probably benign	0.03
IGL00904:Vmn2r74	APN	7	85957580	missense	probably benign	0.05
IGL01285:Vmn2r74	APN	7	85957484	missense	possibly damaging	0.54
IGL01300:Vmn2r74	APN	7	85957206	missense	probably benign	0.00
IGL01410:Vmn2r74	APN	7	85961292	missense	possibly damaging	0.83
IGL01827:Vmn2r74	APN	7	85957592	missense	probably benign	0.00
IGL02094:Vmn2r74	APN	7	85961461	missense	probably benign	0.01
IGL02252:Vmn2r74	APN	7	85957323	missense	probably benign	0.41
IGL02349:Vmn2r74	APN	7	85952516	missense	probably damaging	0.99
IGL02438:Vmn2r74	APN	7	85952616	missense	probably damaging	0.98
IGL02554:Vmn2r74	APN	7	85957373	missense	probably benign	0.00
IGL03036:Vmn2r74	APN	7	85952692	nonsense	probably null
IGL03370:Vmn2r74	APN	7	85958057	missense	probably benign
R0115:Vmn2r74	UTSW	7	85957356	missense	probably benign	0.00
R0333:Vmn2r74	UTSW	7	85952283	missense	probably benign	0.06
R0415:Vmn2r74	UTSW	7	85961410	missense	probably damaging	1.00
R0571:Vmn2r74	UTSW	7	85952421	missense	probably damaging	1.00
R0626:Vmn2r74	UTSW	7	85961309	nonsense	probably null
R0659:Vmn2r74	UTSW	7	85955914	splice site	probably benign
R1202:Vmn2r74	UTSW	7	85961337	missense	possibly damaging	0.83
R1473:Vmn2r74	UTSW	7	85961410	missense	probably damaging	1.00
R1908:Vmn2r74	UTSW	7	85952442	missense	probably benign
R2079:Vmn2r74	UTSW	7	85957175	missense	probably benign	0.00
R2368:Vmn2r74	UTSW	7	85961314	missense	probably benign	0.39
R3782:Vmn2r74	UTSW	7	85956114	missense	probably benign	0.01
R3824:Vmn2r74	UTSW	7	85958258	missense	probably damaging	1.00
R3977:Vmn2r74	UTSW	7	85958137	missense	probably benign	0.01
R4182:Vmn2r74	UTSW	7	85957187	missense	possibly damaging	0.87
R4289:Vmn2r74	UTSW	7	85957354	missense	probably benign
R4294:Vmn2r74	UTSW	7	85957416	missense	probably benign	0.14
R4645:Vmn2r74	UTSW	7	85957109	missense	probably benign
R4646:Vmn2r74	UTSW	7	85957574	missense	probably benign	0.42
R4655:Vmn2r74	UTSW	7	85961347	missense	probably benign
R4901:Vmn2r74	UTSW	7	85955991	nonsense	probably null
R5532:Vmn2r74	UTSW	7	85951989	missense	probably benign	0.32
R5642:Vmn2r74	UTSW	7	85957380	missense	probably benign	0.00
R5913:Vmn2r74	UTSW	7	85951890	missense	probably damaging	0.98
R6035:Vmn2r74	UTSW	7	85951890	missense	probably damaging	0.98
R6035:Vmn2r74	UTSW	7	85951890	missense	probably damaging	0.98
R6039:Vmn2r74	UTSW	7	85958318	critical splice acceptor site	probably null
R6039:Vmn2r74	UTSW	7	85958318	critical splice acceptor site	probably null
R6170:Vmn2r74	UTSW	7	85957140	missense	probably benign	0.03
R6232:Vmn2r74	UTSW	7	85958290	missense	possibly damaging	0.82
R6238:Vmn2r74	UTSW	7	85952072	missense	probably damaging	1.00
R6255:Vmn2r74	UTSW	7	85952451	missense	possibly damaging	0.90
R6468:Vmn2r74	UTSW	7	85961391	missense	probably benign	0.34
R6732:Vmn2r74	UTSW	7	85957550	missense	probably damaging	1.00
R6836:Vmn2r74	UTSW	7	85957422	missense	probably benign	0.00
R6995:Vmn2r74	UTSW	7	85952735	missense	probably benign	0.01
R6995:Vmn2r74	UTSW	7	85957652	critical splice acceptor site	probably null
R7186:Vmn2r74	UTSW	7	85951942	nonsense	probably null
R7246:Vmn2r74	UTSW	7	85955965	missense	probably benign
R7374:Vmn2r74	UTSW	7	85957422	missense	probably benign	0.02
R7505:Vmn2r74	UTSW	7	85957071	nonsense	probably null
R7525:Vmn2r74	UTSW	7	85961302	missense	probably benign
R7569:Vmn2r74	UTSW	7	85952336	missense	probably damaging	0.99
R7644:Vmn2r74	UTSW	7	85957538	missense	probably benign	0.11
R7956:Vmn2r74	UTSW	7	85955958	missense	probably benign	0.09
R8119:Vmn2r74	UTSW	7	85961482	start codon destroyed	probably null	0.08
R8131:Vmn2r74	UTSW	7	85952735	missense	probably benign	0.01
R8147:Vmn2r74	UTSW	7	85956019	nonsense	probably null
R8181:Vmn2r74	UTSW	7	85956116	missense	probably damaging	1.00
R8184:Vmn2r74	UTSW	7	85952246	missense	probably benign	0.00
R8375:Vmn2r74	UTSW	7	85952706	missense	possibly damaging	0.64
R8948:Vmn2r74	UTSW	7	85957361	missense	probably damaging	1.00
R8950:Vmn2r74	UTSW	7	85957361	missense	probably damaging	1.00
R9033:Vmn2r74	UTSW	7	85957206	missense	probably benign
R9342:Vmn2r74	UTSW	7	85957416	missense	probably benign	0.14
R9578:Vmn2r74	UTSW	7	85956893	missense	probably benign	0.01
R9607:Vmn2r74	UTSW	7	85961411	missense	probably benign	0.02
R9776:Vmn2r74	UTSW	7	85956004	missense	possibly damaging	0.70
Z1176:Vmn2r74	UTSW	7	85955627	missense	probably damaging	1.00
Z31818:Vmn2r74	UTSW	7	85955521	splice site	probably null

Predicted Primers

PCR Primer
(F):5'- AGCCAGAAGACACATGGTATC -3'
(R):5'- GTATTAAATAGTGGCACCTGGATG -3'

Sequencing Primer
(F):5'- CTATAATGCCTTGCCTCGTGTTAAAG -3'
(R):5'- GGATGGTTTCACAAAATGTTAATGC -3'

Posted On

2018-10-18