Incidental Mutation 'R6816:Vmn2r74'
ID 537334
Institutional Source Beutler Lab
Gene Symbol Vmn2r74
Ensembl Gene ENSMUSG00000090774
Gene Name vomeronasal 2, receptor 74
Synonyms EG546980
MMRRC Submission 044928-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.110) question?
Stock # R6816 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 85601075-85610690 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 85610621 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Stop codon at position 24 (R24*)
Ref Sequence ENSEMBL: ENSMUSP00000126917 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166355]
AlphaFold E9PW21
Predicted Effect probably null
Transcript: ENSMUST00000166355
AA Change: R24*
SMART Domains Protein: ENSMUSP00000126917
Gene: ENSMUSG00000090774
AA Change: R24*

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 77 467 7.3e-28 PFAM
Pfam:NCD3G 510 562 4.7e-20 PFAM
Pfam:7tm_3 592 830 1.3e-52 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 96% (49/51)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg5 A G 8: 95,668,311 (GRCm39) T458A probably damaging Het
Ajm1 C CTCTA 2: 25,469,733 (GRCm39) probably null Het
Ankrd36 T G 11: 5,593,765 (GRCm39) F457V possibly damaging Het
Cep152 T C 2: 125,436,947 (GRCm39) E531G probably damaging Het
Dpf1 A C 7: 29,011,087 (GRCm39) D162A possibly damaging Het
E2f8 A T 7: 48,525,331 (GRCm39) Y214N possibly damaging Het
Fer1l5 A T 1: 36,445,591 (GRCm39) Y786F possibly damaging Het
Fhod1 G T 8: 106,057,176 (GRCm39) Q933K probably benign Het
Gdap2 T C 3: 100,099,021 (GRCm39) probably null Het
Grin2d A G 7: 45,483,106 (GRCm39) probably benign Het
H2bc22 C T 13: 21,971,947 (GRCm39) S88L probably benign Het
Hgs T A 11: 120,362,397 (GRCm39) V112D probably damaging Het
Igf2r A T 17: 12,932,969 (GRCm39) V851E probably damaging Het
Igfn1 T A 1: 135,887,466 (GRCm39) T2533S probably benign Het
Iqch C T 9: 63,388,041 (GRCm39) V750I probably benign Het
Itih2 A G 2: 10,110,517 (GRCm39) Y525H probably damaging Het
Kcnu1 C T 8: 26,427,762 (GRCm39) Q360* probably null Het
Klk1b26 A G 7: 43,666,292 (GRCm39) N245S probably benign Het
Kmt2c T C 5: 25,610,530 (GRCm39) probably null Het
Lhpp T C 7: 132,235,762 (GRCm39) S116P probably benign Het
Madcam1 A G 10: 79,501,274 (GRCm39) D113G probably damaging Het
Magi3 A T 3: 103,997,227 (GRCm39) probably null Het
Map3k9 A G 12: 81,769,028 (GRCm39) S1007P possibly damaging Het
Mkrn2 C T 6: 115,588,689 (GRCm39) P144L probably damaging Het
Mon1a T C 9: 107,777,609 (GRCm39) S171P probably damaging Het
Nrarp T C 2: 25,071,319 (GRCm39) L66P probably damaging Het
P2ry1 T A 3: 60,911,253 (GRCm39) F131I probably benign Het
Pdzk1 A G 3: 96,761,886 (GRCm39) Q166R probably benign Het
Pigt G T 2: 164,343,052 (GRCm39) V249F probably damaging Het
Ppp1r16b G T 2: 158,603,595 (GRCm39) V407L probably benign Het
Pramel58 A T 5: 94,831,773 (GRCm39) Q260L possibly damaging Het
Rab6a G T 7: 100,279,080 (GRCm39) E73D probably damaging Het
Ralb C A 1: 119,405,712 (GRCm39) G33* probably null Het
Sema3b T A 9: 107,477,549 (GRCm39) M491L probably benign Het
Sema3c A C 5: 17,875,463 (GRCm39) D40A probably benign Het
Slc22a1 T C 17: 12,871,370 (GRCm39) N464D possibly damaging Het
Spire2 T A 8: 124,086,152 (GRCm39) S295T probably benign Het
Stat3 T G 11: 100,802,093 (GRCm39) Q32P probably damaging Het
Sulf2 T C 2: 165,924,674 (GRCm39) T471A probably benign Het
Sult2b1 A G 7: 45,383,102 (GRCm39) W227R probably damaging Het
Syt2 T A 1: 134,673,538 (GRCm39) I294N probably damaging Het
Taar8b A T 10: 23,968,079 (GRCm39) F38L probably benign Het
Tbl2 T A 5: 135,188,069 (GRCm39) probably null Het
Tex48 G A 4: 63,530,192 (GRCm39) S9L probably damaging Het
Tmprss2 A T 16: 97,369,667 (GRCm39) M369K possibly damaging Het
Trip12 A T 1: 84,771,435 (GRCm39) S280T probably damaging Het
Tspoap1 T C 11: 87,656,491 (GRCm39) V263A probably benign Het
Wdr35 G A 12: 9,077,724 (GRCm39) probably null Het
Zfp202 A G 9: 40,123,109 (GRCm39) R624G probably damaging Het
Other mutations in Vmn2r74
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00899:Vmn2r74 APN 7 85,606,338 (GRCm39) missense probably benign 0.03
IGL00904:Vmn2r74 APN 7 85,606,788 (GRCm39) missense probably benign 0.05
IGL01285:Vmn2r74 APN 7 85,606,692 (GRCm39) missense possibly damaging 0.54
IGL01300:Vmn2r74 APN 7 85,606,414 (GRCm39) missense probably benign 0.00
IGL01410:Vmn2r74 APN 7 85,610,500 (GRCm39) missense possibly damaging 0.83
IGL01827:Vmn2r74 APN 7 85,606,800 (GRCm39) missense probably benign 0.00
IGL02094:Vmn2r74 APN 7 85,610,669 (GRCm39) missense probably benign 0.01
IGL02252:Vmn2r74 APN 7 85,606,531 (GRCm39) missense probably benign 0.41
IGL02349:Vmn2r74 APN 7 85,601,724 (GRCm39) missense probably damaging 0.99
IGL02438:Vmn2r74 APN 7 85,601,824 (GRCm39) missense probably damaging 0.98
IGL02554:Vmn2r74 APN 7 85,606,581 (GRCm39) missense probably benign 0.00
IGL03036:Vmn2r74 APN 7 85,601,900 (GRCm39) nonsense probably null
IGL03370:Vmn2r74 APN 7 85,607,265 (GRCm39) missense probably benign
R0115:Vmn2r74 UTSW 7 85,606,564 (GRCm39) missense probably benign 0.00
R0333:Vmn2r74 UTSW 7 85,601,491 (GRCm39) missense probably benign 0.06
R0415:Vmn2r74 UTSW 7 85,610,618 (GRCm39) missense probably damaging 1.00
R0571:Vmn2r74 UTSW 7 85,601,629 (GRCm39) missense probably damaging 1.00
R0626:Vmn2r74 UTSW 7 85,610,517 (GRCm39) nonsense probably null
R0659:Vmn2r74 UTSW 7 85,605,122 (GRCm39) splice site probably benign
R1202:Vmn2r74 UTSW 7 85,610,545 (GRCm39) missense possibly damaging 0.83
R1473:Vmn2r74 UTSW 7 85,610,618 (GRCm39) missense probably damaging 1.00
R1908:Vmn2r74 UTSW 7 85,601,650 (GRCm39) missense probably benign
R2079:Vmn2r74 UTSW 7 85,606,383 (GRCm39) missense probably benign 0.00
R2368:Vmn2r74 UTSW 7 85,610,522 (GRCm39) missense probably benign 0.39
R3782:Vmn2r74 UTSW 7 85,605,322 (GRCm39) missense probably benign 0.01
R3824:Vmn2r74 UTSW 7 85,607,466 (GRCm39) missense probably damaging 1.00
R3977:Vmn2r74 UTSW 7 85,607,345 (GRCm39) missense probably benign 0.01
R4182:Vmn2r74 UTSW 7 85,606,395 (GRCm39) missense possibly damaging 0.87
R4289:Vmn2r74 UTSW 7 85,606,562 (GRCm39) missense probably benign
R4294:Vmn2r74 UTSW 7 85,606,624 (GRCm39) missense probably benign 0.14
R4645:Vmn2r74 UTSW 7 85,606,317 (GRCm39) missense probably benign
R4646:Vmn2r74 UTSW 7 85,606,782 (GRCm39) missense probably benign 0.42
R4655:Vmn2r74 UTSW 7 85,610,555 (GRCm39) missense probably benign
R4901:Vmn2r74 UTSW 7 85,605,199 (GRCm39) nonsense probably null
R5532:Vmn2r74 UTSW 7 85,601,197 (GRCm39) missense probably benign 0.32
R5642:Vmn2r74 UTSW 7 85,606,588 (GRCm39) missense probably benign 0.00
R5913:Vmn2r74 UTSW 7 85,601,098 (GRCm39) missense probably damaging 0.98
R6035:Vmn2r74 UTSW 7 85,601,098 (GRCm39) missense probably damaging 0.98
R6035:Vmn2r74 UTSW 7 85,601,098 (GRCm39) missense probably damaging 0.98
R6039:Vmn2r74 UTSW 7 85,607,526 (GRCm39) critical splice acceptor site probably null
R6039:Vmn2r74 UTSW 7 85,607,526 (GRCm39) critical splice acceptor site probably null
R6170:Vmn2r74 UTSW 7 85,606,348 (GRCm39) missense probably benign 0.03
R6232:Vmn2r74 UTSW 7 85,607,498 (GRCm39) missense possibly damaging 0.82
R6238:Vmn2r74 UTSW 7 85,601,280 (GRCm39) missense probably damaging 1.00
R6255:Vmn2r74 UTSW 7 85,601,659 (GRCm39) missense possibly damaging 0.90
R6468:Vmn2r74 UTSW 7 85,610,599 (GRCm39) missense probably benign 0.34
R6732:Vmn2r74 UTSW 7 85,606,758 (GRCm39) missense probably damaging 1.00
R6836:Vmn2r74 UTSW 7 85,606,630 (GRCm39) missense probably benign 0.00
R6995:Vmn2r74 UTSW 7 85,606,860 (GRCm39) critical splice acceptor site probably null
R6995:Vmn2r74 UTSW 7 85,601,943 (GRCm39) missense probably benign 0.01
R7186:Vmn2r74 UTSW 7 85,601,150 (GRCm39) nonsense probably null
R7246:Vmn2r74 UTSW 7 85,605,173 (GRCm39) missense probably benign
R7374:Vmn2r74 UTSW 7 85,606,630 (GRCm39) missense probably benign 0.02
R7505:Vmn2r74 UTSW 7 85,606,279 (GRCm39) nonsense probably null
R7525:Vmn2r74 UTSW 7 85,610,510 (GRCm39) missense probably benign
R7569:Vmn2r74 UTSW 7 85,601,544 (GRCm39) missense probably damaging 0.99
R7644:Vmn2r74 UTSW 7 85,606,746 (GRCm39) missense probably benign 0.11
R7956:Vmn2r74 UTSW 7 85,605,166 (GRCm39) missense probably benign 0.09
R8119:Vmn2r74 UTSW 7 85,610,690 (GRCm39) start codon destroyed probably null 0.08
R8131:Vmn2r74 UTSW 7 85,601,943 (GRCm39) missense probably benign 0.01
R8147:Vmn2r74 UTSW 7 85,605,227 (GRCm39) nonsense probably null
R8181:Vmn2r74 UTSW 7 85,605,324 (GRCm39) missense probably damaging 1.00
R8184:Vmn2r74 UTSW 7 85,601,454 (GRCm39) missense probably benign 0.00
R8375:Vmn2r74 UTSW 7 85,601,914 (GRCm39) missense possibly damaging 0.64
R8948:Vmn2r74 UTSW 7 85,606,569 (GRCm39) missense probably damaging 1.00
R8950:Vmn2r74 UTSW 7 85,606,569 (GRCm39) missense probably damaging 1.00
R9033:Vmn2r74 UTSW 7 85,606,414 (GRCm39) missense probably benign
R9342:Vmn2r74 UTSW 7 85,606,624 (GRCm39) missense probably benign 0.14
R9578:Vmn2r74 UTSW 7 85,606,101 (GRCm39) missense probably benign 0.01
R9607:Vmn2r74 UTSW 7 85,610,619 (GRCm39) missense probably benign 0.02
R9776:Vmn2r74 UTSW 7 85,605,212 (GRCm39) missense possibly damaging 0.70
Z1176:Vmn2r74 UTSW 7 85,604,835 (GRCm39) missense probably damaging 1.00
Z31818:Vmn2r74 UTSW 7 85,604,729 (GRCm39) splice site probably null
Predicted Primers PCR Primer
(F):5'- AGCCAGAAGACACATGGTATC -3'
(R):5'- GTATTAAATAGTGGCACCTGGATG -3'

Sequencing Primer
(F):5'- CTATAATGCCTTGCCTCGTGTTAAAG -3'
(R):5'- GGATGGTTTCACAAAATGTTAATGC -3'
Posted On 2018-10-18