Incidental Mutation 'R6816:Vmn2r74'
ID 537334
Institutional Source Beutler Lab
Gene Symbol Vmn2r74
Ensembl Gene ENSMUSG00000090774
Gene Name vomeronasal 2, receptor 74
Synonyms EG546980
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock # R6816 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 85951867-85961482 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 85961413 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Stop codon at position 24 (R24*)
Ref Sequence ENSEMBL: ENSMUSP00000126917 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166355]
AlphaFold E9PW21
Predicted Effect probably null
Transcript: ENSMUST00000166355
AA Change: R24*
SMART Domains Protein: ENSMUSP00000126917
Gene: ENSMUSG00000090774
AA Change: R24*

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 77 467 7.3e-28 PFAM
Pfam:NCD3G 510 562 4.7e-20 PFAM
Pfam:7tm_3 592 830 1.3e-52 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 96% (49/51)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg5 A G 8: 94,941,683 T458A probably damaging Het
Ankrd36 T G 11: 5,643,765 F457V possibly damaging Het
Cep152 T C 2: 125,595,027 E531G probably damaging Het
Dpf1 A C 7: 29,311,662 D162A possibly damaging Het
E2f8 A T 7: 48,875,583 Y214N possibly damaging Het
Fer1l5 A T 1: 36,406,510 Y786F possibly damaging Het
Fhod1 G T 8: 105,330,544 Q933K probably benign Het
Gdap2 T C 3: 100,191,705 probably null Het
Gm6205 A T 5: 94,683,914 Q260L possibly damaging Het
Gm996 C CTCTA 2: 25,579,721 probably null Het
Grin2d A G 7: 45,833,682 probably benign Het
Hgs T A 11: 120,471,571 V112D probably damaging Het
Hist1h2bp C T 13: 21,787,777 S88L probably benign Het
Igf2r A T 17: 12,714,082 V851E probably damaging Het
Igfn1 T A 1: 135,959,728 T2533S probably benign Het
Iqch C T 9: 63,480,759 V750I probably benign Het
Itih2 A G 2: 10,105,706 Y525H probably damaging Het
Kcnu1 C T 8: 25,937,734 Q360* probably null Het
Klk1b26 A G 7: 44,016,868 N245S probably benign Het
Kmt2c T C 5: 25,405,532 probably null Het
Lhpp T C 7: 132,634,033 S116P probably benign Het
Madcam1 A G 10: 79,665,440 D113G probably damaging Het
Magi3 A T 3: 104,089,911 probably null Het
Map3k9 A G 12: 81,722,254 S1007P possibly damaging Het
Mkrn2 C T 6: 115,611,728 P144L probably damaging Het
Mon1a T C 9: 107,900,410 S171P probably damaging Het
Nrarp T C 2: 25,181,307 L66P probably damaging Het
P2ry1 T A 3: 61,003,832 F131I probably benign Het
Pdzk1 A G 3: 96,854,570 Q166R probably benign Het
Pigt G T 2: 164,501,132 V249F probably damaging Het
Ppp1r16b G T 2: 158,761,675 V407L probably benign Het
Rab6a G T 7: 100,629,873 E73D probably damaging Het
Ralb C A 1: 119,477,982 G33* probably null Het
Sema3b T A 9: 107,600,350 M491L probably benign Het
Sema3c A C 5: 17,670,465 D40A probably benign Het
Slc22a1 T C 17: 12,652,483 N464D possibly damaging Het
Spire2 T A 8: 123,359,413 S295T probably benign Het
Stat3 T G 11: 100,911,267 Q32P probably damaging Het
Sulf2 T C 2: 166,082,754 T471A probably benign Het
Sult2b1 A G 7: 45,733,678 W227R probably damaging Het
Syt2 T A 1: 134,745,800 I294N probably damaging Het
Taar8b A T 10: 24,092,181 F38L probably benign Het
Tbl2 T A 5: 135,159,215 probably null Het
Tex48 G A 4: 63,611,955 S9L probably damaging Het
Tmprss2 A T 16: 97,568,467 M369K possibly damaging Het
Trip12 A T 1: 84,793,714 S280T probably damaging Het
Tspoap1 T C 11: 87,765,665 V263A probably benign Het
Wdr35 G A 12: 9,027,724 probably null Het
Zfp202 A G 9: 40,211,813 R624G probably damaging Het
Other mutations in Vmn2r74
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00899:Vmn2r74 APN 7 85957130 missense probably benign 0.03
IGL00904:Vmn2r74 APN 7 85957580 missense probably benign 0.05
IGL01285:Vmn2r74 APN 7 85957484 missense possibly damaging 0.54
IGL01300:Vmn2r74 APN 7 85957206 missense probably benign 0.00
IGL01410:Vmn2r74 APN 7 85961292 missense possibly damaging 0.83
IGL01827:Vmn2r74 APN 7 85957592 missense probably benign 0.00
IGL02094:Vmn2r74 APN 7 85961461 missense probably benign 0.01
IGL02252:Vmn2r74 APN 7 85957323 missense probably benign 0.41
IGL02349:Vmn2r74 APN 7 85952516 missense probably damaging 0.99
IGL02438:Vmn2r74 APN 7 85952616 missense probably damaging 0.98
IGL02554:Vmn2r74 APN 7 85957373 missense probably benign 0.00
IGL03036:Vmn2r74 APN 7 85952692 nonsense probably null
IGL03370:Vmn2r74 APN 7 85958057 missense probably benign
R0115:Vmn2r74 UTSW 7 85957356 missense probably benign 0.00
R0333:Vmn2r74 UTSW 7 85952283 missense probably benign 0.06
R0415:Vmn2r74 UTSW 7 85961410 missense probably damaging 1.00
R0571:Vmn2r74 UTSW 7 85952421 missense probably damaging 1.00
R0626:Vmn2r74 UTSW 7 85961309 nonsense probably null
R0659:Vmn2r74 UTSW 7 85955914 splice site probably benign
R1202:Vmn2r74 UTSW 7 85961337 missense possibly damaging 0.83
R1473:Vmn2r74 UTSW 7 85961410 missense probably damaging 1.00
R1908:Vmn2r74 UTSW 7 85952442 missense probably benign
R2079:Vmn2r74 UTSW 7 85957175 missense probably benign 0.00
R2368:Vmn2r74 UTSW 7 85961314 missense probably benign 0.39
R3782:Vmn2r74 UTSW 7 85956114 missense probably benign 0.01
R3824:Vmn2r74 UTSW 7 85958258 missense probably damaging 1.00
R3977:Vmn2r74 UTSW 7 85958137 missense probably benign 0.01
R4182:Vmn2r74 UTSW 7 85957187 missense possibly damaging 0.87
R4289:Vmn2r74 UTSW 7 85957354 missense probably benign
R4294:Vmn2r74 UTSW 7 85957416 missense probably benign 0.14
R4645:Vmn2r74 UTSW 7 85957109 missense probably benign
R4646:Vmn2r74 UTSW 7 85957574 missense probably benign 0.42
R4655:Vmn2r74 UTSW 7 85961347 missense probably benign
R4901:Vmn2r74 UTSW 7 85955991 nonsense probably null
R5532:Vmn2r74 UTSW 7 85951989 missense probably benign 0.32
R5642:Vmn2r74 UTSW 7 85957380 missense probably benign 0.00
R5913:Vmn2r74 UTSW 7 85951890 missense probably damaging 0.98
R6035:Vmn2r74 UTSW 7 85951890 missense probably damaging 0.98
R6035:Vmn2r74 UTSW 7 85951890 missense probably damaging 0.98
R6039:Vmn2r74 UTSW 7 85958318 critical splice acceptor site probably null
R6039:Vmn2r74 UTSW 7 85958318 critical splice acceptor site probably null
R6170:Vmn2r74 UTSW 7 85957140 missense probably benign 0.03
R6232:Vmn2r74 UTSW 7 85958290 missense possibly damaging 0.82
R6238:Vmn2r74 UTSW 7 85952072 missense probably damaging 1.00
R6255:Vmn2r74 UTSW 7 85952451 missense possibly damaging 0.90
R6468:Vmn2r74 UTSW 7 85961391 missense probably benign 0.34
R6732:Vmn2r74 UTSW 7 85957550 missense probably damaging 1.00
R6836:Vmn2r74 UTSW 7 85957422 missense probably benign 0.00
R6995:Vmn2r74 UTSW 7 85952735 missense probably benign 0.01
R6995:Vmn2r74 UTSW 7 85957652 critical splice acceptor site probably null
R7186:Vmn2r74 UTSW 7 85951942 nonsense probably null
R7246:Vmn2r74 UTSW 7 85955965 missense probably benign
R7374:Vmn2r74 UTSW 7 85957422 missense probably benign 0.02
R7505:Vmn2r74 UTSW 7 85957071 nonsense probably null
R7525:Vmn2r74 UTSW 7 85961302 missense probably benign
R7569:Vmn2r74 UTSW 7 85952336 missense probably damaging 0.99
R7644:Vmn2r74 UTSW 7 85957538 missense probably benign 0.11
R7956:Vmn2r74 UTSW 7 85955958 missense probably benign 0.09
R8119:Vmn2r74 UTSW 7 85961482 start codon destroyed probably null 0.08
R8131:Vmn2r74 UTSW 7 85952735 missense probably benign 0.01
R8147:Vmn2r74 UTSW 7 85956019 nonsense probably null
R8181:Vmn2r74 UTSW 7 85956116 missense probably damaging 1.00
R8184:Vmn2r74 UTSW 7 85952246 missense probably benign 0.00
R8375:Vmn2r74 UTSW 7 85952706 missense possibly damaging 0.64
R8948:Vmn2r74 UTSW 7 85957361 missense probably damaging 1.00
R8950:Vmn2r74 UTSW 7 85957361 missense probably damaging 1.00
R9033:Vmn2r74 UTSW 7 85957206 missense probably benign
R9342:Vmn2r74 UTSW 7 85957416 missense probably benign 0.14
R9578:Vmn2r74 UTSW 7 85956893 missense probably benign 0.01
R9607:Vmn2r74 UTSW 7 85961411 missense probably benign 0.02
R9776:Vmn2r74 UTSW 7 85956004 missense possibly damaging 0.70
Z1176:Vmn2r74 UTSW 7 85955627 missense probably damaging 1.00
Z31818:Vmn2r74 UTSW 7 85955521 splice site probably null
Predicted Primers PCR Primer
(F):5'- AGCCAGAAGACACATGGTATC -3'
(R):5'- GTATTAAATAGTGGCACCTGGATG -3'

Sequencing Primer
(F):5'- CTATAATGCCTTGCCTCGTGTTAAAG -3'
(R):5'- GGATGGTTTCACAAAATGTTAATGC -3'
Posted On 2018-10-18