Incidental Mutation 'R6816:Lhpp'
ID 537336
Institutional Source Beutler Lab
Gene Symbol Lhpp
Ensembl Gene ENSMUSG00000030946
Gene Name phospholysine phosphohistidine inorganic pyrophosphate phosphatase
Synonyms 2310007H09Rik
MMRRC Submission 044928-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.320) question?
Stock # R6816 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 132212367-132308149 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 132235762 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 116 (S116P)
Ref Sequence ENSEMBL: ENSMUSP00000033241 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033241] [ENSMUST00000106170] [ENSMUST00000124096] [ENSMUST00000148669]
AlphaFold Q9D7I5
Predicted Effect probably benign
Transcript: ENSMUST00000033241
AA Change: S116P

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000033241
Gene: ENSMUSG00000030946
AA Change: S116P

DomainStartEndE-ValueType
Pfam:Hydrolase 11 227 1.1e-8 PFAM
Pfam:Hydrolase_6 14 116 4.4e-17 PFAM
Pfam:HAD_2 159 233 3.4e-9 PFAM
Pfam:Hydrolase_like 186 260 9.2e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106170
AA Change: S116P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133969
Predicted Effect probably benign
Transcript: ENSMUST00000148669
Meta Mutation Damage Score 0.1639 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 96% (49/51)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrg5 A G 8: 95,668,311 (GRCm39) T458A probably damaging Het
Ajm1 C CTCTA 2: 25,469,733 (GRCm39) probably null Het
Ankrd36 T G 11: 5,593,765 (GRCm39) F457V possibly damaging Het
Cep152 T C 2: 125,436,947 (GRCm39) E531G probably damaging Het
Dpf1 A C 7: 29,011,087 (GRCm39) D162A possibly damaging Het
E2f8 A T 7: 48,525,331 (GRCm39) Y214N possibly damaging Het
Fer1l5 A T 1: 36,445,591 (GRCm39) Y786F possibly damaging Het
Fhod1 G T 8: 106,057,176 (GRCm39) Q933K probably benign Het
Gdap2 T C 3: 100,099,021 (GRCm39) probably null Het
Grin2d A G 7: 45,483,106 (GRCm39) probably benign Het
H2bc22 C T 13: 21,971,947 (GRCm39) S88L probably benign Het
Hgs T A 11: 120,362,397 (GRCm39) V112D probably damaging Het
Igf2r A T 17: 12,932,969 (GRCm39) V851E probably damaging Het
Igfn1 T A 1: 135,887,466 (GRCm39) T2533S probably benign Het
Iqch C T 9: 63,388,041 (GRCm39) V750I probably benign Het
Itih2 A G 2: 10,110,517 (GRCm39) Y525H probably damaging Het
Kcnu1 C T 8: 26,427,762 (GRCm39) Q360* probably null Het
Klk1b26 A G 7: 43,666,292 (GRCm39) N245S probably benign Het
Kmt2c T C 5: 25,610,530 (GRCm39) probably null Het
Madcam1 A G 10: 79,501,274 (GRCm39) D113G probably damaging Het
Magi3 A T 3: 103,997,227 (GRCm39) probably null Het
Map3k9 A G 12: 81,769,028 (GRCm39) S1007P possibly damaging Het
Mkrn2 C T 6: 115,588,689 (GRCm39) P144L probably damaging Het
Mon1a T C 9: 107,777,609 (GRCm39) S171P probably damaging Het
Nrarp T C 2: 25,071,319 (GRCm39) L66P probably damaging Het
P2ry1 T A 3: 60,911,253 (GRCm39) F131I probably benign Het
Pdzk1 A G 3: 96,761,886 (GRCm39) Q166R probably benign Het
Pigt G T 2: 164,343,052 (GRCm39) V249F probably damaging Het
Ppp1r16b G T 2: 158,603,595 (GRCm39) V407L probably benign Het
Pramel58 A T 5: 94,831,773 (GRCm39) Q260L possibly damaging Het
Rab6a G T 7: 100,279,080 (GRCm39) E73D probably damaging Het
Ralb C A 1: 119,405,712 (GRCm39) G33* probably null Het
Sema3b T A 9: 107,477,549 (GRCm39) M491L probably benign Het
Sema3c A C 5: 17,875,463 (GRCm39) D40A probably benign Het
Slc22a1 T C 17: 12,871,370 (GRCm39) N464D possibly damaging Het
Spire2 T A 8: 124,086,152 (GRCm39) S295T probably benign Het
Stat3 T G 11: 100,802,093 (GRCm39) Q32P probably damaging Het
Sulf2 T C 2: 165,924,674 (GRCm39) T471A probably benign Het
Sult2b1 A G 7: 45,383,102 (GRCm39) W227R probably damaging Het
Syt2 T A 1: 134,673,538 (GRCm39) I294N probably damaging Het
Taar8b A T 10: 23,968,079 (GRCm39) F38L probably benign Het
Tbl2 T A 5: 135,188,069 (GRCm39) probably null Het
Tex48 G A 4: 63,530,192 (GRCm39) S9L probably damaging Het
Tmprss2 A T 16: 97,369,667 (GRCm39) M369K possibly damaging Het
Trip12 A T 1: 84,771,435 (GRCm39) S280T probably damaging Het
Tspoap1 T C 11: 87,656,491 (GRCm39) V263A probably benign Het
Vmn2r74 T A 7: 85,610,621 (GRCm39) R24* probably null Het
Wdr35 G A 12: 9,077,724 (GRCm39) probably null Het
Zfp202 A G 9: 40,123,109 (GRCm39) R624G probably damaging Het
Other mutations in Lhpp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01414:Lhpp APN 7 132,244,249 (GRCm39) missense probably damaging 1.00
IGL02695:Lhpp APN 7 132,252,063 (GRCm39) missense probably damaging 1.00
IGL03220:Lhpp APN 7 132,252,020 (GRCm39) missense probably benign 0.02
R0105:Lhpp UTSW 7 132,232,254 (GRCm39) missense probably damaging 0.99
R0200:Lhpp UTSW 7 132,212,406 (GRCm39) start gained probably benign
R0463:Lhpp UTSW 7 132,212,406 (GRCm39) start gained probably benign
R1103:Lhpp UTSW 7 132,212,484 (GRCm39) missense probably damaging 1.00
R1872:Lhpp UTSW 7 132,235,816 (GRCm39) missense probably benign 0.24
R4816:Lhpp UTSW 7 132,272,104 (GRCm39) nonsense probably null
R5140:Lhpp UTSW 7 132,307,361 (GRCm39) missense probably damaging 0.99
R5799:Lhpp UTSW 7 132,307,364 (GRCm39) missense probably damaging 1.00
R8503:Lhpp UTSW 7 132,307,406 (GRCm39) missense probably benign
R8738:Lhpp UTSW 7 132,243,261 (GRCm39) missense probably damaging 1.00
R8996:Lhpp UTSW 7 132,212,484 (GRCm39) missense probably damaging 1.00
R9108:Lhpp UTSW 7 132,252,018 (GRCm39) missense probably damaging 1.00
R9474:Lhpp UTSW 7 132,243,312 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTTCCCAGCTTCAGGTCTG -3'
(R):5'- GAAGCTGTCTCTACGCGG -3'

Sequencing Primer
(F):5'- ATAGTGACACTGCCTATGAGCCTG -3'
(R):5'- TCTCTACGCGGCCCCAG -3'
Posted On 2018-10-18