Incidental Mutation 'R6817:Mgat4a'
ID537358
Institutional Source Beutler Lab
Gene Symbol Mgat4a
Ensembl Gene ENSMUSG00000026110
Gene Namemannoside acetylglucosaminyltransferase 4, isoenzyme A
Synonyms9530018I07Rik, GnT-IVa
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.230) question?
Stock #R6817 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location37439340-37541016 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 37449123 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 472 (R472*)
Ref Sequence ENSEMBL: ENSMUSP00000121181 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042161] [ENSMUST00000143636] [ENSMUST00000151952] [ENSMUST00000154819]
Predicted Effect probably null
Transcript: ENSMUST00000042161
AA Change: R481*
SMART Domains Protein: ENSMUSP00000038894
Gene: ENSMUSG00000026110
AA Change: R481*

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
coiled coil region 28 63 N/A INTRINSIC
Pfam:Glyco_transf_54 75 380 5.8e-137 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000143636
AA Change: R343*
SMART Domains Protein: ENSMUSP00000122909
Gene: ENSMUSG00000026110
AA Change: R343*

DomainStartEndE-ValueType
Pfam:Glyco_transf_54 1 242 1.2e-123 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000151952
AA Change: R481*
SMART Domains Protein: ENSMUSP00000114175
Gene: ENSMUSG00000026110
AA Change: R481*

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
coiled coil region 28 63 N/A INTRINSIC
Pfam:Glyco_transf_54 86 380 7.5e-139 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000154819
AA Change: R472*
SMART Domains Protein: ENSMUSP00000121181
Gene: ENSMUSG00000026110
AA Change: R472*

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
coiled coil region 28 63 N/A INTRINSIC
Pfam:Glyco_transf_54 71 371 4.8e-137 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a key glycosyltransferase that regulates the formation of tri- and multiantennary branching structures in the Golgi apparatus. The encoded protein, in addition to the related isoenzyme B, catalyzes the transfer of N-acetylglucosamine (GlcNAc) from UDP-GlcNAc in a beta-1,4 linkage to the Man-alpha-1,3-Man-beta-1,4-GlcNAc arm of R-Man-alpha-1,6(GlcNAc-beta-1,2-Man-alpha-1,3)Man-beta-1,4-GlcNAc-beta-1,4-GlcNAc-beta-1-Asn. The encoded protein may play a role in regulating the availability of serum glycoproteins, oncogenesis, and differentiation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show defects in glucose-stimulated insulin secretion, impaired cellular glucose import, increased susceptibility to weight gain, hyperglycemia, impaired glucose tolerance, insulin resistance, high free fatty acid and triglyceride levels, and hepatic steatosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apeh G A 9: 108,092,679 H186Y probably damaging Het
Arhgap21 A C 2: 20,880,296 L690R probably benign Het
Asxl3 A G 18: 22,523,580 N1549S probably benign Het
Cast T C 13: 74,699,158 T670A possibly damaging Het
Cd109 A G 9: 78,714,955 D1409G probably benign Het
Cemip A G 7: 83,987,992 F311S probably damaging Het
Cfap43 T A 19: 47,756,085 I1210F possibly damaging Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Cops5 G A 1: 10,030,604 L256F probably benign Het
Cux1 T C 5: 136,373,173 probably null Het
Dab1 A G 4: 104,679,546 K178E probably damaging Het
Ddc A G 11: 11,824,854 Y346H probably damaging Het
Dlg2 T G 7: 91,965,664 D225E probably benign Het
Dsg1b A T 18: 20,394,405 I198F probably damaging Het
Ect2l T C 10: 18,174,059 H155R probably benign Het
Epha2 A G 4: 141,308,994 H247R probably damaging Het
Esrp1 A G 4: 11,357,552 V355A probably damaging Het
Fam78b A G 1: 167,078,850 M193V possibly damaging Het
Gdpd4 A G 7: 97,957,830 T4A probably benign Het
Gm17175 T C 14: 51,573,021 N50D possibly damaging Het
Kcnt2 A G 1: 140,246,193 probably benign Het
Lpo T C 11: 87,809,241 N525D probably benign Het
Lrrc41 G A 4: 116,089,305 E406K possibly damaging Het
Lrrc59 G C 11: 94,630,065 D21H probably damaging Het
Mroh7 C T 4: 106,714,115 A14T probably benign Het
Muc5b T C 7: 141,862,913 S3199P probably benign Het
Muc6 T A 7: 141,651,061 Y270F probably damaging Het
Myo18b T A 5: 112,830,238 T1273S probably benign Het
Nos2 A T 11: 78,945,266 E385V possibly damaging Het
Nsl1 T G 1: 191,063,274 probably null Het
Nup93 T C 8: 94,314,682 probably null Het
Olfr1175-ps A T 2: 88,322,763 M314K probably benign Het
Pcna-ps2 T G 19: 9,283,497 M40R probably damaging Het
Pik3r5 A G 11: 68,486,581 E148G probably damaging Het
Pirt A G 11: 66,925,911 E16G probably damaging Het
Pkp4 T C 2: 59,318,600 Y566H probably damaging Het
Psg17 A C 7: 18,814,640 V402G probably damaging Het
Ptprb GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT 10: 116,283,677 probably benign Het
Rassf7 A G 7: 141,217,447 E191G probably damaging Het
Rnf213 T C 11: 119,462,285 probably null Het
Slc34a2 C T 5: 53,064,028 T272I probably damaging Het
Sos2 T C 12: 69,618,161 E332G probably benign Het
Spdye4c T C 2: 128,596,510 Y263H probably damaging Het
Tmprss11f C T 5: 86,556,934 V42I probably benign Het
Trpv5 T A 6: 41,658,007 N463Y possibly damaging Het
Ush2a A T 1: 188,862,864 Q3831L probably benign Het
Wdr41 C A 13: 94,997,304 probably null Het
Zfand1 A G 3: 10,340,824 C246R probably benign Het
Other mutations in Mgat4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Mgat4a APN 1 37449123 nonsense probably null
IGL01720:Mgat4a APN 1 37444898 missense probably damaging 1.00
IGL02103:Mgat4a APN 1 37462926 missense possibly damaging 0.94
IGL03177:Mgat4a APN 1 37444887 missense probably damaging 1.00
R0090:Mgat4a UTSW 1 37490333 missense probably damaging 1.00
R0269:Mgat4a UTSW 1 37490307 missense possibly damaging 0.89
R0635:Mgat4a UTSW 1 37452294 missense probably benign 0.11
R1114:Mgat4a UTSW 1 37464406 splice site probably benign
R1120:Mgat4a UTSW 1 37452581 missense probably damaging 1.00
R1466:Mgat4a UTSW 1 37464406 splice site probably benign
R1940:Mgat4a UTSW 1 37536037 critical splice donor site probably null
R2257:Mgat4a UTSW 1 37490313 missense probably benign 0.13
R2293:Mgat4a UTSW 1 37452592 missense probably damaging 0.99
R2370:Mgat4a UTSW 1 37464533 missense probably damaging 0.96
R2392:Mgat4a UTSW 1 37498704 missense probably damaging 1.00
R3952:Mgat4a UTSW 1 37450414 splice site probably benign
R4563:Mgat4a UTSW 1 37466579 missense probably damaging 1.00
R5424:Mgat4a UTSW 1 37466555 missense probably benign 0.01
R5494:Mgat4a UTSW 1 37454817 missense probably damaging 1.00
R5505:Mgat4a UTSW 1 37495954 missense probably benign 0.04
R5938:Mgat4a UTSW 1 37452263 missense probably damaging 0.99
R6237:Mgat4a UTSW 1 37456592 missense probably damaging 1.00
R6589:Mgat4a UTSW 1 37444895 missense probably damaging 0.99
R6825:Mgat4a UTSW 1 37464434 nonsense probably null
R7402:Mgat4a UTSW 1 37454784 missense probably damaging 1.00
R7507:Mgat4a UTSW 1 37452527 missense probably damaging 1.00
X0063:Mgat4a UTSW 1 37462890 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ATCAGAAACCCAGTCTGGCC -3'
(R):5'- TGCTCTGTAAGGAACACTTAGATC -3'

Sequencing Primer
(F):5'- AAACCCAGTCTGGCCAAGGG -3'
(R):5'- GCATGGCTGAAATAACTTCTACC -3'
Posted On2018-10-18