Mutagenetix > Incidental Mutation

Incidental Mutation 'R6817:Nup93'

537384

Institutional Source

Beutler Lab

Gene Symbol

Nup93

Ensembl Gene

ENSMUSG00000032939

Gene Name

nucleoporin 93

Synonyms

2410008G02Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.914) question?

Stock #

R6817 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

94214564-94317227 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to C at 94314682 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000148458 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000079961] [ENSMUST00000109547] [ENSMUST00000211822] [ENSMUST00000212824]

AlphaFold

Q8BJ71

Predicted Effect

probably benign
Transcript: ENSMUST00000079961
AA Change: V816A

PolyPhen 2 Score 0.416 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000078878
Gene: ENSMUSG00000032939
AA Change: V816A

Domain	Start	End	E-Value	Type
low complexity region	8	19	N/A	INTRINSIC
low complexity region	42	52	N/A	INTRINSIC
Pfam:Nic96	214	804	6.9e-198	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000109547
AA Change: V816A

PolyPhen 2 Score 0.416 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000105174
Gene: ENSMUSG00000032939
AA Change: V816A

Domain	Start	End	E-Value	Type
low complexity region	8	19	N/A	INTRINSIC
low complexity region	42	52	N/A	INTRINSIC
Pfam:Nic96	202	804	8.2e-202	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000211822

Predicted Effect

probably benign
Transcript: ENSMUST00000212824
AA Change: V816A

PolyPhen 2 Score 0.416 (Sensitivity: 0.89; Specificity: 0.90)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

96% (47/49)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nuclear pore complex is a massive structure that extends across the nuclear envelope, forming a gateway that regulates the flow of macromolecules between the nucleus and the cytoplasm. Nucleoporins are the main components of the nuclear pore complex in eukaryotic cells. This gene encodes a nucleoporin protein that localizes both to the basket of the pore and to the nuclear entry of the central gated channel of the pore. The encoded protein is a target of caspase cysteine proteases that play a central role in programmed cell death by apoptosis. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2016]

Allele List at MGI

Other mutations in this stock

Total: 48 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Apeh	G	A	9: 108,092,679	H186Y	probably damaging	Het
Arhgap21	A	C	2: 20,880,296	L690R	probably benign	Het
Asxl3	A	G	18: 22,523,580	N1549S	probably benign	Het
Cast	T	C	13: 74,699,158	T670A	possibly damaging	Het
Cd109	A	G	9: 78,714,955	D1409G	probably benign	Het
Cemip	A	G	7: 83,987,992	F311S	probably damaging	Het
Cfap43	T	A	19: 47,756,085	I1210F	possibly damaging	Het
Cmtm1	CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT	CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT	8: 104,309,470		probably benign	Het
Cops5	G	A	1: 10,030,604	L256F	probably benign	Het
Cux1	T	C	5: 136,373,173		probably null	Het
Dab1	A	G	4: 104,679,546	K178E	probably damaging	Het
Ddc	A	G	11: 11,824,854	Y346H	probably damaging	Het
Dlg2	T	G	7: 91,965,664	D225E	probably benign	Het
Dsg1b	A	T	18: 20,394,405	I198F	probably damaging	Het
Ect2l	T	C	10: 18,174,059	H155R	probably benign	Het
Epha2	A	G	4: 141,308,994	H247R	probably damaging	Het
Esrp1	A	G	4: 11,357,552	V355A	probably damaging	Het
Fam78b	A	G	1: 167,078,850	M193V	possibly damaging	Het
Gdpd4	A	G	7: 97,957,830	T4A	probably benign	Het
Gm17175	T	C	14: 51,573,021	N50D	possibly damaging	Het
Kcnt2	A	G	1: 140,246,193		probably benign	Het
Lpo	T	C	11: 87,809,241	N525D	probably benign	Het
Lrrc41	G	A	4: 116,089,305	E406K	possibly damaging	Het
Lrrc59	G	C	11: 94,630,065	D21H	probably damaging	Het
Mgat4a	G	A	1: 37,449,123	R472*	probably null	Het
Mroh7	C	T	4: 106,714,115	A14T	probably benign	Het
Muc5b	T	C	7: 141,862,913	S3199P	probably benign	Het
Muc6	T	A	7: 141,651,061	Y270F	probably damaging	Het
Myo18b	T	A	5: 112,830,238	T1273S	probably benign	Het
Nos2	A	T	11: 78,945,266	E385V	possibly damaging	Het
Nsl1	T	G	1: 191,063,274		probably null	Het
Olfr1175-ps	A	T	2: 88,322,763	M314K	probably benign	Het
Pcna-ps2	T	G	19: 9,283,497	M40R	probably damaging	Het
Pik3r5	A	G	11: 68,486,581	E148G	probably damaging	Het
Pirt	A	G	11: 66,925,911	E16G	probably damaging	Het
Pkp4	T	C	2: 59,318,600	Y566H	probably damaging	Het
Psg17	A	C	7: 18,814,640	V402G	probably damaging	Het
Ptprb	GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT	GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT	10: 116,283,677		probably benign	Het
Rassf7	A	G	7: 141,217,447	E191G	probably damaging	Het
Rnf213	T	C	11: 119,462,285		probably null	Het
Slc34a2	C	T	5: 53,064,028	T272I	probably damaging	Het
Sos2	T	C	12: 69,618,161	E332G	probably benign	Het
Spdye4c	T	C	2: 128,596,510	Y263H	probably damaging	Het
Tmprss11f	C	T	5: 86,556,934	V42I	probably benign	Het
Trpv5	T	A	6: 41,658,007	N463Y	possibly damaging	Het
Ush2a	A	T	1: 188,862,864	Q3831L	probably benign	Het
Wdr41	C	A	13: 94,997,304		probably null	Het
Zfand1	A	G	3: 10,340,824	C246R	probably benign	Het

Other mutations in Nup93

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00783:Nup93	APN	8	94309023	critical splice donor site	probably null
IGL01652:Nup93	APN	8	94296559	missense	possibly damaging	0.93
IGL02003:Nup93	APN	8	94302109	nonsense	probably null
IGL02169:Nup93	APN	8	94302129	missense	probably damaging	1.00
IGL02212:Nup93	APN	8	94311662	critical splice donor site	probably null
IGL02551:Nup93	APN	8	94227833	nonsense	probably null
IGL02568:Nup93	APN	8	94309635	missense	probably damaging	1.00
IGL03094:Nup93	APN	8	94296502	missense	probably benign
IGL03248:Nup93	APN	8	94306088	missense	probably damaging	0.98
IGL03273:Nup93	APN	8	94306277	missense	probably benign	0.01
IGL03401:Nup93	APN	8	94309711	splice site	probably null
PIT4585001:Nup93	UTSW	8	94243727	missense	probably benign	0.25
R0409:Nup93	UTSW	8	94303665	missense	probably damaging	1.00
R0748:Nup93	UTSW	8	94307943	missense	probably damaging	1.00
R0891:Nup93	UTSW	8	94281263	splice site	probably benign
R1667:Nup93	UTSW	8	94292687	missense	possibly damaging	0.71
R1696:Nup93	UTSW	8	94296555	missense	probably benign	0.29
R1862:Nup93	UTSW	8	94306102	missense	probably damaging	1.00
R2069:Nup93	UTSW	8	94243739	missense	probably damaging	1.00
R2143:Nup93	UTSW	8	94296480	nonsense	probably null
R2187:Nup93	UTSW	8	94300850	missense	probably damaging	1.00
R2228:Nup93	UTSW	8	94304191	missense	probably benign	0.27
R2229:Nup93	UTSW	8	94304191	missense	probably benign	0.27
R2254:Nup93	UTSW	8	94227857	critical splice donor site	probably null
R2884:Nup93	UTSW	8	94303638	missense	probably damaging	1.00
R4521:Nup93	UTSW	8	94314636	missense	probably damaging	1.00
R4563:Nup93	UTSW	8	94307892	missense	probably damaging	1.00
R4900:Nup93	UTSW	8	94286603	missense	probably benign	0.25
R5570:Nup93	UTSW	8	94314670	missense	probably damaging	1.00
R6226:Nup93	UTSW	8	94286537	missense	probably damaging	1.00
R6489:Nup93	UTSW	8	94302088	missense	probably benign	0.10
R6658:Nup93	UTSW	8	94304179	missense	probably benign	0.02
R6895:Nup93	UTSW	8	94243686	missense	probably damaging	1.00
R6955:Nup93	UTSW	8	94309673	missense	probably damaging	0.96
R7476:Nup93	UTSW	8	94303632	missense	probably damaging	1.00
R7643:Nup93	UTSW	8	94286619	critical splice donor site	probably null
R7994:Nup93	UTSW	8	94306302	missense	probably benign	0.15
R8461:Nup93	UTSW	8	94281335	critical splice donor site	probably null
R9177:Nup93	UTSW	8	94227743	missense	probably benign	0.25
R9264:Nup93	UTSW	8	94292720	missense	probably benign	0.01
R9532:Nup93	UTSW	8	94314621	missense	probably damaging	1.00
R9567:Nup93	UTSW	8	94308976	missense	possibly damaging	0.94
R9629:Nup93	UTSW	8	94306639	missense	probably damaging	0.99
R9721:Nup93	UTSW	8	94303685	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCTGACACTGAGTGCACAAC -3'
(R):5'- CAACTGTGGACAACATTTCCCAAG -3'

Sequencing Primer
(F):5'- CTGACACTGAGTGCACAACATAGAAG -3'
(R):5'- GCCCACGTGCCTAATATAC -3'

Posted On

2018-10-18