Incidental Mutation 'R6817:Ect2l'
ID537387
Institutional Source Beutler Lab
Gene Symbol Ect2l
Ensembl Gene ENSMUSG00000071392
Gene Nameepithelial cell transforming sequence 2 oncogene-like
SynonymsC330021H03Rik, Gm10331
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R6817 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location18128903-18210890 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 18174059 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 155 (H155R)
Ref Sequence ENSEMBL: ENSMUSP00000146899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095817] [ENSMUST00000207827] [ENSMUST00000208948] [ENSMUST00000209178]
Predicted Effect probably benign
Transcript: ENSMUST00000095817
AA Change: H155R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000093497
Gene: ENSMUSG00000071392
AA Change: H155R

DomainStartEndE-ValueType
FBOX 93 133 3.5e-4 SMART
Pfam:DUF4347 297 468 1.4e-11 PFAM
RhoGEF 578 761 6.3e-46 SMART
Blast:PH 793 909 6e-49 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000207827
AA Change: H155R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000208948
AA Change: H155R

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000209178
AA Change: H63R

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 96% (47/49)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apeh G A 9: 108,092,679 H186Y probably damaging Het
Arhgap21 A C 2: 20,880,296 L690R probably benign Het
Asxl3 A G 18: 22,523,580 N1549S probably benign Het
Cast T C 13: 74,699,158 T670A possibly damaging Het
Cd109 A G 9: 78,714,955 D1409G probably benign Het
Cemip A G 7: 83,987,992 F311S probably damaging Het
Cfap43 T A 19: 47,756,085 I1210F possibly damaging Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Cops5 G A 1: 10,030,604 L256F probably benign Het
Cux1 T C 5: 136,373,173 probably null Het
Dab1 A G 4: 104,679,546 K178E probably damaging Het
Ddc A G 11: 11,824,854 Y346H probably damaging Het
Dlg2 T G 7: 91,965,664 D225E probably benign Het
Dsg1b A T 18: 20,394,405 I198F probably damaging Het
Epha2 A G 4: 141,308,994 H247R probably damaging Het
Esrp1 A G 4: 11,357,552 V355A probably damaging Het
Fam78b A G 1: 167,078,850 M193V possibly damaging Het
Gdpd4 A G 7: 97,957,830 T4A probably benign Het
Gm17175 T C 14: 51,573,021 N50D possibly damaging Het
Kcnt2 A G 1: 140,246,193 probably benign Het
Lpo T C 11: 87,809,241 N525D probably benign Het
Lrrc41 G A 4: 116,089,305 E406K possibly damaging Het
Lrrc59 G C 11: 94,630,065 D21H probably damaging Het
Mgat4a G A 1: 37,449,123 R472* probably null Het
Mroh7 C T 4: 106,714,115 A14T probably benign Het
Muc5b T C 7: 141,862,913 S3199P probably benign Het
Muc6 T A 7: 141,651,061 Y270F probably damaging Het
Myo18b T A 5: 112,830,238 T1273S probably benign Het
Nos2 A T 11: 78,945,266 E385V possibly damaging Het
Nsl1 T G 1: 191,063,274 probably null Het
Nup93 T C 8: 94,314,682 probably null Het
Olfr1175-ps A T 2: 88,322,763 M314K probably benign Het
Pcna-ps2 T G 19: 9,283,497 M40R probably damaging Het
Pik3r5 A G 11: 68,486,581 E148G probably damaging Het
Pirt A G 11: 66,925,911 E16G probably damaging Het
Pkp4 T C 2: 59,318,600 Y566H probably damaging Het
Psg17 A C 7: 18,814,640 V402G probably damaging Het
Ptprb GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT 10: 116,283,677 probably benign Het
Rassf7 A G 7: 141,217,447 E191G probably damaging Het
Rnf213 T C 11: 119,462,285 probably null Het
Slc34a2 C T 5: 53,064,028 T272I probably damaging Het
Sos2 T C 12: 69,618,161 E332G probably benign Het
Spdye4c T C 2: 128,596,510 Y263H probably damaging Het
Tmprss11f C T 5: 86,556,934 V42I probably benign Het
Trpv5 T A 6: 41,658,007 N463Y possibly damaging Het
Ush2a A T 1: 188,862,864 Q3831L probably benign Het
Wdr41 C A 13: 94,997,304 probably null Het
Zfand1 A G 3: 10,340,824 C246R probably benign Het
Other mutations in Ect2l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01555:Ect2l APN 10 18130730 missense probably damaging 1.00
IGL01773:Ect2l APN 10 18161504 missense probably damaging 0.97
IGL02293:Ect2l APN 10 18140511 critical splice donor site probably null
IGL02589:Ect2l APN 10 18140594 splice site probably benign
IGL02866:Ect2l APN 10 18159817 missense probably damaging 1.00
R0037:Ect2l UTSW 10 18143097 missense probably damaging 1.00
R0526:Ect2l UTSW 10 18199940 missense possibly damaging 0.92
R0628:Ect2l UTSW 10 18143040 missense probably damaging 1.00
R0839:Ect2l UTSW 10 18141904 missense probably benign 0.03
R0948:Ect2l UTSW 10 18140586 missense probably damaging 1.00
R1103:Ect2l UTSW 10 18140526 missense probably damaging 1.00
R1238:Ect2l UTSW 10 18143104 missense possibly damaging 0.94
R1326:Ect2l UTSW 10 18165542 missense probably benign 0.00
R1327:Ect2l UTSW 10 18165542 missense probably benign 0.00
R1544:Ect2l UTSW 10 18168434 missense probably benign 0.04
R1848:Ect2l UTSW 10 18200033 missense probably damaging 1.00
R1921:Ect2l UTSW 10 18143004 missense possibly damaging 0.89
R1938:Ect2l UTSW 10 18144635 missense probably benign 0.00
R2081:Ect2l UTSW 10 18165527 missense probably damaging 1.00
R3551:Ect2l UTSW 10 18163393 missense probably damaging 1.00
R3608:Ect2l UTSW 10 18142940 missense possibly damaging 0.92
R3886:Ect2l UTSW 10 18168458 missense probably damaging 1.00
R4120:Ect2l UTSW 10 18130718 missense probably benign 0.00
R4348:Ect2l UTSW 10 18136988 missense probably damaging 1.00
R4992:Ect2l UTSW 10 18172729 missense probably benign 0.00
R5053:Ect2l UTSW 10 18140345 missense probably damaging 1.00
R5144:Ect2l UTSW 10 18144577 missense probably benign 0.03
R5654:Ect2l UTSW 10 18143062 missense probably damaging 0.99
R5779:Ect2l UTSW 10 18163438 missense probably benign 0.09
R5814:Ect2l UTSW 10 18200009 missense probably damaging 0.97
R6053:Ect2l UTSW 10 18141844 missense probably damaging 1.00
R6057:Ect2l UTSW 10 18161502 missense probably benign 0.02
R6244:Ect2l UTSW 10 18140397 missense possibly damaging 0.93
R6720:Ect2l UTSW 10 18140264 missense probably damaging 1.00
R6894:Ect2l UTSW 10 18169380 critical splice donor site probably null
R7199:Ect2l UTSW 10 18129146 missense probably benign 0.02
R7313:Ect2l UTSW 10 18168401 missense probably damaging 0.98
R7404:Ect2l UTSW 10 18159781 missense probably damaging 0.99
R7482:Ect2l UTSW 10 18168454 missense probably benign 0.07
X0018:Ect2l UTSW 10 18130652 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GCCTCTTACTCTTGCGGAAG -3'
(R):5'- TAGTCACCAAAACCACTTCTCATATGG -3'

Sequencing Primer
(F):5'- GCGGAAGGCAATGTTCTCC -3'
(R):5'- GTGTGCATGCCTGAAACTA -3'
Posted On2018-10-18