Incidental Mutation 'R6817:Nos2'
ID 537391
Institutional Source Beutler Lab
Gene Symbol Nos2
Ensembl Gene ENSMUSG00000020826
Gene Name nitric oxide synthase 2, inducible
Synonyms Nos2a, NOS-II, Nos-2, iNOS
MMRRC Submission 044929-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6817 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 78811613-78851052 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 78836092 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Valine at position 385 (E385V)
Ref Sequence ENSEMBL: ENSMUSP00000150558 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018610] [ENSMUST00000214397]
AlphaFold P29477
Predicted Effect possibly damaging
Transcript: ENSMUST00000018610
AA Change: E498V

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000018610
Gene: ENSMUSG00000020826
AA Change: E498V

DomainStartEndE-ValueType
Pfam:NO_synthase 129 491 6.7e-189 PFAM
Pfam:Flavodoxin_1 535 666 5.5e-43 PFAM
Pfam:FAD_binding_1 719 941 8.8e-79 PFAM
Pfam:NAD_binding_1 973 1087 4.1e-24 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000214397
AA Change: E385V

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)
Meta Mutation Damage Score 0.0783 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: Nitric oxide is a reactive free radical which acts as a biologic mediator in several processes, including neurotransmission and antimicrobial and antitumoral activities. This gene encodes a nitric oxide synthase that is inducible by a combination of lipopolysaccharide and certain cytokines. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous deletion of this gene alters susceptibility to infection, response to injury, sepsis and sensory stimuli, cardiac function, osteoclast, platelet and mammary gland physiology, tumor growth, testis and uterus morphology, diet-induced atherosclerosis, and blood, urine and glucose metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apeh G A 9: 107,969,878 (GRCm39) H186Y probably damaging Het
Arhgap21 A C 2: 20,885,107 (GRCm39) L690R probably benign Het
Asxl3 A G 18: 22,656,637 (GRCm39) N1549S probably benign Het
Cast T C 13: 74,847,277 (GRCm39) T670A possibly damaging Het
Cd109 A G 9: 78,622,237 (GRCm39) D1409G probably benign Het
Cemip A G 7: 83,637,200 (GRCm39) F311S probably damaging Het
Cfap43 T A 19: 47,744,524 (GRCm39) I1210F possibly damaging Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 105,036,102 (GRCm39) probably benign Het
Cops5 G A 1: 10,100,829 (GRCm39) L256F probably benign Het
Cux1 T C 5: 136,402,027 (GRCm39) probably null Het
Dab1 A G 4: 104,536,743 (GRCm39) K178E probably damaging Het
Ddc A G 11: 11,774,854 (GRCm39) Y346H probably damaging Het
Dlg2 T G 7: 91,614,872 (GRCm39) D225E probably benign Het
Dsg1b A T 18: 20,527,462 (GRCm39) I198F probably damaging Het
Ect2l T C 10: 18,049,807 (GRCm39) H155R probably benign Het
Epha2 A G 4: 141,036,305 (GRCm39) H247R probably damaging Het
Esrp1 A G 4: 11,357,552 (GRCm39) V355A probably damaging Het
Fam78b A G 1: 166,906,419 (GRCm39) M193V possibly damaging Het
Gdpd4 A G 7: 97,607,037 (GRCm39) T4A probably benign Het
Gm17175 T C 14: 51,810,478 (GRCm39) N50D possibly damaging Het
Kcnt2 A G 1: 140,173,931 (GRCm39) probably benign Het
Lpo T C 11: 87,700,067 (GRCm39) N525D probably benign Het
Lrrc41 G A 4: 115,946,502 (GRCm39) E406K possibly damaging Het
Lrrc59 G C 11: 94,520,891 (GRCm39) D21H probably damaging Het
Mgat4a G A 1: 37,488,204 (GRCm39) R472* probably null Het
Mroh7 C T 4: 106,571,312 (GRCm39) A14T probably benign Het
Muc5b T C 7: 141,416,650 (GRCm39) S3199P probably benign Het
Muc6 T A 7: 141,237,326 (GRCm39) Y270F probably damaging Het
Myo18b T A 5: 112,978,104 (GRCm39) T1273S probably benign Het
Nsl1 T G 1: 190,795,471 (GRCm39) probably null Het
Nup93 T C 8: 95,041,310 (GRCm39) probably null Het
Or5d45 A T 2: 88,153,107 (GRCm39) M314K probably benign Het
Pcna-ps2 T G 19: 9,260,861 (GRCm39) M40R probably damaging Het
Pik3r5 A G 11: 68,377,407 (GRCm39) E148G probably damaging Het
Pirt A G 11: 66,816,737 (GRCm39) E16G probably damaging Het
Pkp4 T C 2: 59,148,944 (GRCm39) Y566H probably damaging Het
Psg17 A C 7: 18,548,565 (GRCm39) V402G probably damaging Het
Ptprb GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT 10: 116,119,582 (GRCm39) probably benign Het
Rassf7 A G 7: 140,797,360 (GRCm39) E191G probably damaging Het
Rnf213 T C 11: 119,353,111 (GRCm39) probably null Het
Slc34a2 C T 5: 53,221,370 (GRCm39) T272I probably damaging Het
Sos2 T C 12: 69,664,935 (GRCm39) E332G probably benign Het
Spdye4c T C 2: 128,438,430 (GRCm39) Y263H probably damaging Het
Tmprss11f C T 5: 86,704,793 (GRCm39) V42I probably benign Het
Trpv5 T A 6: 41,634,941 (GRCm39) N463Y possibly damaging Het
Ush2a A T 1: 188,595,061 (GRCm39) Q3831L probably benign Het
Wdr41 C A 13: 95,133,812 (GRCm39) probably null Het
Zfand1 A G 3: 10,405,884 (GRCm39) C246R probably benign Het
Other mutations in Nos2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01388:Nos2 APN 11 78,848,278 (GRCm39) missense probably damaging 0.96
IGL01503:Nos2 APN 11 78,836,689 (GRCm39) splice site probably benign
IGL01789:Nos2 APN 11 78,835,483 (GRCm39) splice site probably benign
IGL02797:Nos2 APN 11 78,831,170 (GRCm39) missense probably damaging 1.00
IGL02968:Nos2 APN 11 78,828,463 (GRCm39) missense probably damaging 1.00
R6762_Nos2_754 UTSW 11 78,850,574 (GRCm39) missense possibly damaging 0.90
R0035:Nos2 UTSW 11 78,836,553 (GRCm39) missense probably damaging 1.00
R0265:Nos2 UTSW 11 78,828,428 (GRCm39) missense probably damaging 0.98
R0441:Nos2 UTSW 11 78,819,409 (GRCm39) missense probably benign 0.10
R0504:Nos2 UTSW 11 78,830,903 (GRCm39) missense probably damaging 1.00
R0570:Nos2 UTSW 11 78,826,187 (GRCm39) missense possibly damaging 0.49
R1356:Nos2 UTSW 11 78,843,629 (GRCm39) missense probably benign 0.00
R1538:Nos2 UTSW 11 78,847,396 (GRCm39) missense probably benign 0.00
R3414:Nos2 UTSW 11 78,848,414 (GRCm39) missense probably benign 0.14
R3418:Nos2 UTSW 11 78,850,521 (GRCm39) missense possibly damaging 0.47
R4279:Nos2 UTSW 11 78,820,602 (GRCm39) missense probably benign 0.01
R4492:Nos2 UTSW 11 78,840,921 (GRCm39) missense probably benign
R4632:Nos2 UTSW 11 78,848,417 (GRCm39) missense possibly damaging 0.95
R4686:Nos2 UTSW 11 78,819,456 (GRCm39) missense possibly damaging 0.65
R5038:Nos2 UTSW 11 78,813,140 (GRCm39) missense probably benign
R5214:Nos2 UTSW 11 78,846,267 (GRCm39) missense probably damaging 1.00
R5377:Nos2 UTSW 11 78,848,317 (GRCm39) missense probably benign 0.00
R5777:Nos2 UTSW 11 78,830,978 (GRCm39) missense probably null 1.00
R5834:Nos2 UTSW 11 78,819,405 (GRCm39) missense probably benign 0.01
R5930:Nos2 UTSW 11 78,828,741 (GRCm39) missense probably damaging 1.00
R6511:Nos2 UTSW 11 78,846,290 (GRCm39) splice site probably null
R6706:Nos2 UTSW 11 78,835,549 (GRCm39) missense possibly damaging 0.60
R6747:Nos2 UTSW 11 78,843,780 (GRCm39) missense probably damaging 0.99
R6762:Nos2 UTSW 11 78,850,574 (GRCm39) missense possibly damaging 0.90
R6868:Nos2 UTSW 11 78,848,332 (GRCm39) missense probably benign 0.02
R6917:Nos2 UTSW 11 78,842,053 (GRCm39) missense possibly damaging 0.50
R7082:Nos2 UTSW 11 78,819,405 (GRCm39) missense probably benign 0.02
R7286:Nos2 UTSW 11 78,820,680 (GRCm39) missense probably damaging 1.00
R7367:Nos2 UTSW 11 78,840,916 (GRCm39) missense possibly damaging 0.77
R7398:Nos2 UTSW 11 78,827,297 (GRCm39) nonsense probably null
R7411:Nos2 UTSW 11 78,835,681 (GRCm39) critical splice donor site probably null
R7469:Nos2 UTSW 11 78,843,797 (GRCm39) missense possibly damaging 0.94
R7736:Nos2 UTSW 11 78,813,192 (GRCm39) nonsense probably null
R8694:Nos2 UTSW 11 78,836,515 (GRCm39) missense possibly damaging 0.93
R8832:Nos2 UTSW 11 78,846,290 (GRCm39) splice site probably null
R8872:Nos2 UTSW 11 78,839,949 (GRCm39) missense probably damaging 0.99
R8952:Nos2 UTSW 11 78,836,089 (GRCm39) missense probably benign 0.00
R9433:Nos2 UTSW 11 78,850,490 (GRCm39) missense probably damaging 1.00
R9580:Nos2 UTSW 11 78,828,457 (GRCm39) missense probably benign 0.01
R9612:Nos2 UTSW 11 78,839,984 (GRCm39) missense probably damaging 1.00
R9727:Nos2 UTSW 11 78,843,825 (GRCm39) missense possibly damaging 0.51
R9747:Nos2 UTSW 11 78,822,472 (GRCm39) missense probably damaging 0.96
X0063:Nos2 UTSW 11 78,813,193 (GRCm39) missense probably benign 0.01
Z1177:Nos2 UTSW 11 78,822,498 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- TGACCATGACAAAGGAAGCC -3'
(R):5'- TTCTGGGAGCCAACACCAAAAG -3'

Sequencing Primer
(F):5'- AAGTGCCCACTGCTGTGTG -3'
(R):5'- AAGGGACATTCTCCGTATGC -3'
Posted On 2018-10-18