Incidental Mutation 'R6817:Nos2'
ID537391
Institutional Source Beutler Lab
Gene Symbol Nos2
Ensembl Gene ENSMUSG00000020826
Gene Namenitric oxide synthase 2, inducible
SynonymsiNOS, Nos-2, Nos2a, NOS-II
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6817 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location78920787-78960254 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 78945266 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 385 (E385V)
Ref Sequence ENSEMBL: ENSMUSP00000150558 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018610] [ENSMUST00000214397]
Predicted Effect possibly damaging
Transcript: ENSMUST00000018610
AA Change: E498V

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000018610
Gene: ENSMUSG00000020826
AA Change: E498V

DomainStartEndE-ValueType
Pfam:NO_synthase 129 491 6.7e-189 PFAM
Pfam:Flavodoxin_1 535 666 5.5e-43 PFAM
Pfam:FAD_binding_1 719 941 8.8e-79 PFAM
Pfam:NAD_binding_1 973 1087 4.1e-24 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000214397
AA Change: E385V

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)
Meta Mutation Damage Score 0.0783 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 96% (47/49)
MGI Phenotype FUNCTION: Nitric oxide is a reactive free radical which acts as a biologic mediator in several processes, including neurotransmission and antimicrobial and antitumoral activities. This gene encodes a nitric oxide synthase that is inducible by a combination of lipopolysaccharide and certain cytokines. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous deletion of this gene alters susceptibility to infection, response to injury, sepsis and sensory stimuli, cardiac function, osteoclast, platelet and mammary gland physiology, tumor growth, testis and uterus morphology, diet-induced atherosclerosis, and blood, urine and glucose metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apeh G A 9: 108,092,679 H186Y probably damaging Het
Arhgap21 A C 2: 20,880,296 L690R probably benign Het
Asxl3 A G 18: 22,523,580 N1549S probably benign Het
Cast T C 13: 74,699,158 T670A possibly damaging Het
Cd109 A G 9: 78,714,955 D1409G probably benign Het
Cemip A G 7: 83,987,992 F311S probably damaging Het
Cfap43 T A 19: 47,756,085 I1210F possibly damaging Het
Cmtm1 CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT CGGCACGTACTGAAGGTCGCTGACTGGATGGTGTGGCACGTACTGAAGGTCGCTGACTGGATGGT 8: 104,309,470 probably benign Het
Cops5 G A 1: 10,030,604 L256F probably benign Het
Cux1 T C 5: 136,373,173 probably null Het
Dab1 A G 4: 104,679,546 K178E probably damaging Het
Ddc A G 11: 11,824,854 Y346H probably damaging Het
Dlg2 T G 7: 91,965,664 D225E probably benign Het
Dsg1b A T 18: 20,394,405 I198F probably damaging Het
Ect2l T C 10: 18,174,059 H155R probably benign Het
Epha2 A G 4: 141,308,994 H247R probably damaging Het
Esrp1 A G 4: 11,357,552 V355A probably damaging Het
Fam78b A G 1: 167,078,850 M193V possibly damaging Het
Gdpd4 A G 7: 97,957,830 T4A probably benign Het
Gm17175 T C 14: 51,573,021 N50D possibly damaging Het
Kcnt2 A G 1: 140,246,193 probably benign Het
Lpo T C 11: 87,809,241 N525D probably benign Het
Lrrc41 G A 4: 116,089,305 E406K possibly damaging Het
Lrrc59 G C 11: 94,630,065 D21H probably damaging Het
Mgat4a G A 1: 37,449,123 R472* probably null Het
Mroh7 C T 4: 106,714,115 A14T probably benign Het
Muc5b T C 7: 141,862,913 S3199P probably benign Het
Muc6 T A 7: 141,651,061 Y270F probably damaging Het
Myo18b T A 5: 112,830,238 T1273S probably benign Het
Nsl1 T G 1: 191,063,274 probably null Het
Nup93 T C 8: 94,314,682 probably null Het
Olfr1175-ps A T 2: 88,322,763 M314K probably benign Het
Pcna-ps2 T G 19: 9,283,497 M40R probably damaging Het
Pik3r5 A G 11: 68,486,581 E148G probably damaging Het
Pirt A G 11: 66,925,911 E16G probably damaging Het
Pkp4 T C 2: 59,318,600 Y566H probably damaging Het
Psg17 A C 7: 18,814,640 V402G probably damaging Het
Ptprb GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT GAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACTGCAAAGACCCTCGGGAGCACT 10: 116,283,677 probably benign Het
Rassf7 A G 7: 141,217,447 E191G probably damaging Het
Rnf213 T C 11: 119,462,285 probably null Het
Slc34a2 C T 5: 53,064,028 T272I probably damaging Het
Sos2 T C 12: 69,618,161 E332G probably benign Het
Spdye4c T C 2: 128,596,510 Y263H probably damaging Het
Tmprss11f C T 5: 86,556,934 V42I probably benign Het
Trpv5 T A 6: 41,658,007 N463Y possibly damaging Het
Ush2a A T 1: 188,862,864 Q3831L probably benign Het
Wdr41 C A 13: 94,997,304 probably null Het
Zfand1 A G 3: 10,340,824 C246R probably benign Het
Other mutations in Nos2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01388:Nos2 APN 11 78957452 missense probably damaging 0.96
IGL01503:Nos2 APN 11 78945863 splice site probably benign
IGL01789:Nos2 APN 11 78944657 splice site probably benign
IGL02797:Nos2 APN 11 78940344 missense probably damaging 1.00
IGL02968:Nos2 APN 11 78937637 missense probably damaging 1.00
R0035:Nos2 UTSW 11 78945727 missense probably damaging 1.00
R0265:Nos2 UTSW 11 78937602 missense probably damaging 0.98
R0441:Nos2 UTSW 11 78928583 missense probably benign 0.10
R0504:Nos2 UTSW 11 78940077 missense probably damaging 1.00
R0570:Nos2 UTSW 11 78935361 missense possibly damaging 0.49
R1356:Nos2 UTSW 11 78952803 missense probably benign 0.00
R1538:Nos2 UTSW 11 78956570 missense probably benign 0.00
R3414:Nos2 UTSW 11 78957588 missense probably benign 0.14
R3418:Nos2 UTSW 11 78959695 missense possibly damaging 0.47
R4279:Nos2 UTSW 11 78929776 missense probably benign 0.01
R4492:Nos2 UTSW 11 78950095 missense probably benign
R4632:Nos2 UTSW 11 78957591 missense possibly damaging 0.95
R4686:Nos2 UTSW 11 78928630 missense possibly damaging 0.65
R5038:Nos2 UTSW 11 78922314 missense probably benign
R5214:Nos2 UTSW 11 78955441 missense probably damaging 1.00
R5377:Nos2 UTSW 11 78957491 missense probably benign 0.00
R5777:Nos2 UTSW 11 78940152 missense probably null 1.00
R5834:Nos2 UTSW 11 78928579 missense probably benign 0.01
R5930:Nos2 UTSW 11 78937915 missense probably damaging 1.00
R6511:Nos2 UTSW 11 78955464 splice site probably null
R6706:Nos2 UTSW 11 78944723 missense possibly damaging 0.60
R6747:Nos2 UTSW 11 78952954 missense probably damaging 0.99
R6762:Nos2 UTSW 11 78959748 missense possibly damaging 0.90
R6868:Nos2 UTSW 11 78957506 missense probably benign 0.02
R6917:Nos2 UTSW 11 78951227 missense possibly damaging 0.50
R7082:Nos2 UTSW 11 78928579 missense probably benign 0.02
R7286:Nos2 UTSW 11 78929854 missense probably damaging 1.00
R7367:Nos2 UTSW 11 78950090 missense possibly damaging 0.77
R7398:Nos2 UTSW 11 78936471 nonsense probably null
R7411:Nos2 UTSW 11 78944855 critical splice donor site probably null
R7469:Nos2 UTSW 11 78952971 missense possibly damaging 0.94
R7736:Nos2 UTSW 11 78922366 nonsense probably null
R8694:Nos2 UTSW 11 78945689 missense possibly damaging 0.93
R8832:Nos2 UTSW 11 78955464 splice site probably null
R8872:Nos2 UTSW 11 78949123 missense probably damaging 0.99
R8952:Nos2 UTSW 11 78945263 missense probably benign 0.00
X0063:Nos2 UTSW 11 78922367 missense probably benign 0.01
Z1177:Nos2 UTSW 11 78931672 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGACCATGACAAAGGAAGCC -3'
(R):5'- TTCTGGGAGCCAACACCAAAAG -3'

Sequencing Primer
(F):5'- AAGTGCCCACTGCTGTGTG -3'
(R):5'- AAGGGACATTCTCCGTATGC -3'
Posted On2018-10-18