Mutagenetix > Incidental Mutation

Incidental Mutation 'R6818:Scn2a'

537407

Institutional Source

Beutler Lab

Gene Symbol

Scn2a

Ensembl Gene

ENSMUSG00000075318

Gene Name

sodium channel, voltage-gated, type II, alpha

Synonyms

A230052E19Rik, Scn2a1, Nav1.2

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6818 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

65620771-65767447 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to A at 65688669 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Stop codon at position 413 (S413*)

Ref Sequence

ENSEMBL: ENSMUSP00000143882 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028377] [ENSMUST00000100067] [ENSMUST00000144254] [ENSMUST00000200829]

AlphaFold

B1AWN6

Predicted Effect

probably null
Transcript: ENSMUST00000028377
AA Change: S413*

SMART Domains

Protein: ENSMUSP00000028377
Gene: ENSMUSG00000075318
AA Change: S413*

Domain	Start	End	E-Value	Type
Pfam:Ion_trans	128	436	2.2e-81	PFAM
low complexity region	450	471	N/A	INTRINSIC
Pfam:Na_trans_cytopl	505	710	9.6e-83	PFAM
Pfam:Ion_trans	759	994	3.6e-57	PFAM
Pfam:Na_trans_assoc	998	1204	1.7e-63	PFAM
Pfam:Ion_trans	1208	1484	3.3e-66	PFAM
Pfam:Ion_trans	1531	1788	2.8e-57	PFAM
Pfam:PKD_channel	1627	1782	8.6e-7	PFAM
IQ	1905	1927	3.59e-3	SMART
low complexity region	1967	1975	N/A	INTRINSIC
low complexity region	1981	2000	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000100067
AA Change: S413*

SMART Domains

Protein: ENSMUSP00000097645
Gene: ENSMUSG00000075318
AA Change: S413*

Domain	Start	End	E-Value	Type
Pfam:Ion_trans	157	424	3.3e-75	PFAM
low complexity region	433	448	N/A	INTRINSIC
low complexity region	450	471	N/A	INTRINSIC
Pfam:DUF3451	488	711	2.6e-66	PFAM
Pfam:Ion_trans	794	983	1.1e-47	PFAM
Pfam:Na_trans_assoc	998	1219	3.5e-77	PFAM
Pfam:Ion_trans	1245	1473	4.4e-55	PFAM
PDB:1BYY\|A	1475	1527	3e-31	PDB
Pfam:Ion_trans	1566	1776	2.4e-52	PFAM
Pfam:PKD_channel	1628	1783	3.6e-7	PFAM
IQ	1905	1927	3.59e-3	SMART
low complexity region	1967	1975	N/A	INTRINSIC
low complexity region	1981	2000	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000144254
AA Change: S413*

SMART Domains

Protein: ENSMUSP00000117955
Gene: ENSMUSG00000075318
AA Change: S413*

Domain	Start	End	E-Value	Type
Pfam:Ion_trans	128	436	7.2e-81	PFAM
low complexity region	450	471	N/A	INTRINSIC
low complexity region	484	502	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000200829
AA Change: S413*

SMART Domains

Protein: ENSMUSP00000143882
Gene: ENSMUSG00000075318
AA Change: S413*

Domain	Start	End	E-Value	Type
Pfam:Ion_trans	128	436	1.2e-79	PFAM
low complexity region	450	471	N/A	INTRINSIC
Pfam:Na_trans_cytopl	505	710	7.1e-80	PFAM
Pfam:Ion_trans	759	994	2.1e-55	PFAM
Pfam:Na_trans_assoc	998	1204	8e-61	PFAM
Pfam:Ion_trans	1208	1484	1.9e-64	PFAM
Pfam:Ion_trans	1531	1788	1.6e-55	PFAM
Pfam:PKD_channel	1627	1782	1.2e-4	PFAM
IQ	1905	1927	1.8e-5	SMART
low complexity region	1967	1975	N/A	INTRINSIC
low complexity region	1981	2000	N/A	INTRINSIC

Meta Mutation Damage Score

0.9717

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

97% (59/61)

MGI Phenotype

FUNCTION: Voltage-gated sodium channels are transmembrane glycoprotein complexes composed of a large alpha subunit with four repeat domains, each of which is composed of six membrane-spanning segments, and one or more regulatory beta subunits. Voltage-gated sodium channels are responsible for the generation and propagation of action potentials in neurons and muscle. This gene encodes one member of the sodium channel alpha subunit gene family. In humans, variants of this gene are associated with seizure disorders and autism spectrum disorder. Mice homozygous for a knockout mutation die with severe hypoxia and extensive neuronal cell death, while gain of function mutations result in progressive seizure disorder. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2016]
PHENOTYPE: Homozygotes for a targeted mutation exhibit excess neuronal apoptosis (especially in the brainstem), reduced neuronal sodium channel currents in vitro, and severe hypoxia resulting in neonatal lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb5	T	A	12: 118,901,354		probably null	Het
Acot4	A	C	12: 84,042,009	E210D	probably damaging	Het
Adamts9	A	C	6: 92,905,191	S476A	probably damaging	Het
Ak1	T	A	2: 32,630,373	M61K	probably damaging	Het
Ambp	G	T	4: 63,154,006	S17*	probably null	Het
Anxa6	T	A	11: 54,979,500	M662L	probably benign	Het
Atp11b	T	C	3: 35,814,180	I467T	possibly damaging	Het
B3gat1	G	T	9: 26,751,702		probably benign	Het
Bccip	T	G	7: 133,717,759	I193S	probably damaging	Het
Ccdc170	A	G	10: 4,541,782	E401G	probably damaging	Het
Cldn16	A	G	16: 26,477,507	T78A	probably damaging	Het
Cldn24	G	T	8: 47,822,722	A194S	probably benign	Het
Cltc	A	G	11: 86,704,228	V1348A	possibly damaging	Het
Clvs1	T	C	4: 9,282,014		probably null	Het
Csmd1	C	T	8: 16,185,327	D1161N	probably damaging	Het
Cuzd1	A	G	7: 131,316,665	V181A	probably damaging	Het
Dhx30	A	G	9: 110,088,031	I435T	probably damaging	Het
Dip2b	T	C	15: 100,193,954	V858A	probably benign	Het
Dnmt3b	C	T	2: 153,686,284	T822M	probably damaging	Het
Dock10	A	T	1: 80,615,365	F97I	possibly damaging	Het
Dock8	T	C	19: 25,169,501		probably null	Het
Dvl2	T	C	11: 70,009,273	L631P	probably damaging	Het
Faf2	T	A	13: 54,641,606		probably null	Het
Fat2	T	A	11: 55,309,341	H969L	probably benign	Het
Fsip2	T	A	2: 82,985,200	V3759E	probably benign	Het
Gm10037	A	G	13: 67,833,867	Q66R	possibly damaging	Het
Gm10985	A	C	3: 53,845,253	Y19S	probably damaging	Het
Gm973	T	C	1: 59,630,169	L793P	probably damaging	Het
Gm996	C	CTCTA	2: 25,579,721		probably null	Het
H2-M1	A	G	17: 36,670,435	I236T	probably damaging	Het
Hif1a	A	T	12: 73,945,563	R765*	probably null	Het
Htt	A	G	5: 34,782,767	K77E	probably damaging	Het
Ift172	G	T	5: 31,265,960	Q826K	probably benign	Het
Inafm1	C	T	7: 16,273,161	A44T	probably damaging	Het
Kctd4	A	G	14: 75,963,308	T240A	probably damaging	Het
Klk1	A	T	7: 44,229,459	I124F	probably damaging	Het
Kremen1	T	C	11: 5,195,051	T442A	probably benign	Het
Mei4	T	A	9: 82,025,521	D202E	probably benign	Het
Mest	T	A	6: 30,746,287	D284E	probably damaging	Het
Nsfl1c	T	A	2: 151,503,020	Y95*	probably null	Het
Olfr121	T	A	17: 37,752,424	V190D	possibly damaging	Het
Olfr1282	T	G	2: 111,335,314	I255L	probably benign	Het
Olfr1349	T	C	7: 6,514,551	M293V	probably damaging	Het
Olfr316	T	A	11: 58,757,957	C97*	probably null	Het
Pgm2	T	A	4: 99,963,566	I220N	probably damaging	Het
Pirt	T	A	11: 66,925,893	V10E	possibly damaging	Het
Prl7d1	C	A	13: 27,714,471	M19I	probably benign	Het
Samhd1	T	C	2: 157,107,497	N490D	probably benign	Het
Serpinb6e	A	T	13: 33,832,354		probably null	Het
Slitrk5	A	G	14: 111,680,294	D450G	probably benign	Het
Tchh	A	G	3: 93,443,411	T53A	probably damaging	Het
Tmem44	A	T	16: 30,543,221		probably null	Het
Tpm3-rs7	A	G	14: 113,315,016	E114G	possibly damaging	Het
Treml2	A	G	17: 48,302,897	Y119C	probably damaging	Het
Ubxn1	T	A	19: 8,873,881		probably null	Het
Vmn2r84	A	T	10: 130,386,278	M691K	probably benign	Het
Vmn2r97	A	T	17: 18,947,931	I816F	possibly damaging	Het
Was	GCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTC	GCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTC	X: 8,086,211		probably benign	Het
Wfdc2	T	C	2: 164,563,150		probably null	Het
Zscan4-ps3	T	C	7: 11,613,059	S341P	probably damaging	Het

Other mutations in Scn2a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00088:Scn2a	APN	2	65764440	missense	probably benign
IGL00159:Scn2a	APN	2	65743090	missense	probably damaging	1.00
IGL00418:Scn2a	APN	2	65764522	missense	probably benign	0.43
IGL00753:Scn2a	APN	2	65683863	missense	possibly damaging	0.66
IGL00770:Scn2a	APN	2	65735853	missense	probably damaging	1.00
IGL00774:Scn2a	APN	2	65735853	missense	probably damaging	1.00
IGL00847:Scn2a	APN	2	65670734	missense	probably damaging	1.00
IGL01155:Scn2a	APN	2	65717748	missense	probably damaging	1.00
IGL01329:Scn2a	APN	2	65717508	missense	probably benign	0.05
IGL01537:Scn2a	APN	2	65715875	missense	probably benign	0.00
IGL01672:Scn2a	APN	2	65751934	missense	probably damaging	1.00
IGL01958:Scn2a	APN	2	65701829	missense	probably damaging	1.00
IGL02028:Scn2a	APN	2	65763658	missense	probably damaging	0.96
IGL02142:Scn2a	APN	2	65715838	missense	probably damaging	1.00
IGL02160:Scn2a	APN	2	65730116	missense	probably damaging	1.00
IGL02183:Scn2a	APN	2	65671603	missense	probably benign	0.20
IGL02341:Scn2a	APN	2	65688377	missense	probably damaging	1.00
IGL02504:Scn2a	APN	2	65683884	missense	probably benign	0.02
IGL02530:Scn2a	APN	2	65730178	missense	probably damaging	0.99
IGL02621:Scn2a	APN	2	65748879	splice site	probably benign
IGL02652:Scn2a	APN	2	65702038	missense	possibly damaging	0.82
IGL02966:Scn2a	APN	2	65701844	missense	possibly damaging	0.93
IGL03188:Scn2a	APN	2	65671653	missense	probably damaging	0.99
IGL03329:Scn2a	APN	2	65764629	missense	probably benign
IGL03336:Scn2a	APN	2	65688744	missense	probably damaging	1.00
IGL03391:Scn2a	APN	2	65764213	missense	probably damaging	1.00
PIT4280001:Scn2a	UTSW	2	65715730	missense	probably damaging	1.00
PIT4362001:Scn2a	UTSW	2	65683838	missense	probably benign	0.09
PIT4403001:Scn2a	UTSW	2	65711908	missense	probably damaging	1.00
PIT4520001:Scn2a	UTSW	2	65688419	missense	probably damaging	1.00
R0021:Scn2a	UTSW	2	65670515	missense	possibly damaging	0.51
R0141:Scn2a	UTSW	2	65711816	missense	probably benign	0.01
R0240:Scn2a	UTSW	2	65735774	missense	probably benign	0.32
R0240:Scn2a	UTSW	2	65735774	missense	probably benign	0.32
R0335:Scn2a	UTSW	2	65682091	missense	probably damaging	1.00
R0508:Scn2a	UTSW	2	65717842	missense	probably damaging	0.99
R0558:Scn2a	UTSW	2	65711925	missense	probably benign	0.26
R0600:Scn2a	UTSW	2	65701833	missense	possibly damaging	0.90
R0667:Scn2a	UTSW	2	65751996	missense	possibly damaging	0.91
R1178:Scn2a	UTSW	2	65686779	splice site	probably benign
R1244:Scn2a	UTSW	2	65763655	missense	probably damaging	0.98
R1386:Scn2a	UTSW	2	65688741	missense	probably damaging	1.00
R1434:Scn2a	UTSW	2	65701991	missense	possibly damaging	0.79
R1440:Scn2a	UTSW	2	65764594	missense	probably benign
R1448:Scn2a	UTSW	2	65683845	missense	probably benign	0.17
R1460:Scn2a	UTSW	2	65701843	missense	probably damaging	0.96
R1553:Scn2a	UTSW	2	65713836	nonsense	probably null
R1642:Scn2a	UTSW	2	65683697	missense	probably damaging	1.00
R1803:Scn2a	UTSW	2	65670767	splice site	probably null
R1981:Scn2a	UTSW	2	65690170	missense	probably damaging	1.00
R2002:Scn2a	UTSW	2	65682083	missense	probably null	1.00
R2068:Scn2a	UTSW	2	65752073	missense	probably benign	0.14
R2125:Scn2a	UTSW	2	65752079	nonsense	probably null
R2126:Scn2a	UTSW	2	65752079	nonsense	probably null
R2876:Scn2a	UTSW	2	65715897	missense	possibly damaging	0.64
R2878:Scn2a	UTSW	2	65688371	missense	probably damaging	1.00
R3113:Scn2a	UTSW	2	65748785	missense	possibly damaging	0.86
R3749:Scn2a	UTSW	2	65713771	missense	probably damaging	1.00
R3750:Scn2a	UTSW	2	65713771	missense	probably damaging	1.00
R3765:Scn2a	UTSW	2	65682710	missense	possibly damaging	0.51
R3850:Scn2a	UTSW	2	65682031	missense	probably benign	0.14
R4585:Scn2a	UTSW	2	65743051	splice site	probably null
R4586:Scn2a	UTSW	2	65743051	splice site	probably null
R4588:Scn2a	UTSW	2	65713767	missense	possibly damaging	0.76
R4622:Scn2a	UTSW	2	65752027	missense	probably benign	0.04
R5108:Scn2a	UTSW	2	65688630	missense	probably damaging	1.00
R5161:Scn2a	UTSW	2	65764591	missense	probably benign	0.00
R5235:Scn2a	UTSW	2	65752011	missense	probably damaging	1.00
R5464:Scn2a	UTSW	2	65701756	missense	probably damaging	1.00
R5586:Scn2a	UTSW	2	65707295	nonsense	probably null
R5630:Scn2a	UTSW	2	65726365	missense	probably damaging	1.00
R5715:Scn2a	UTSW	2	65717584	missense	probably benign	0.27
R5730:Scn2a	UTSW	2	65682538	nonsense	probably null
R5734:Scn2a	UTSW	2	65717722	missense	possibly damaging	0.49
R5779:Scn2a	UTSW	2	65764483	missense	probably benign	0.00
R6133:Scn2a	UTSW	2	65743104	missense	probably benign	0.35
R6547:Scn2a	UTSW	2	65715897	missense	probably benign	0.29
R6549:Scn2a	UTSW	2	65764674	missense	probably benign	0.05
R6999:Scn2a	UTSW	2	65682109	missense	probably benign
R7069:Scn2a	UTSW	2	65764606	missense	probably benign	0.00
R7073:Scn2a	UTSW	2	65728443	missense	probably benign	0.00
R7125:Scn2a	UTSW	2	65763933	missense	probably damaging	1.00
R7178:Scn2a	UTSW	2	65748853	nonsense	probably null
R7179:Scn2a	UTSW	2	65701979	missense	probably damaging	1.00
R7203:Scn2a	UTSW	2	65748319	missense	probably benign	0.01
R7227:Scn2a	UTSW	2	65752023	missense	probably damaging	0.98
R7269:Scn2a	UTSW	2	65763769	missense	probably damaging	1.00
R7358:Scn2a	UTSW	2	65682506	nonsense	probably null
R7388:Scn2a	UTSW	2	65688654	missense	probably damaging	1.00
R7491:Scn2a	UTSW	2	65702008	missense	probably damaging	0.99
R7619:Scn2a	UTSW	2	65715903	missense	probably damaging	1.00
R7695:Scn2a	UTSW	2	65711907	missense	probably damaging	0.99
R7735:Scn2a	UTSW	2	65763669	missense	probably benign	0.40
R7911:Scn2a	UTSW	2	65682083	missense	probably null	1.00
R8096:Scn2a	UTSW	2	65764022	missense	probably damaging	0.98
R8172:Scn2a	UTSW	2	65690328	missense	probably benign	0.01
R8220:Scn2a	UTSW	2	65690276	missense	probably benign	0.01
R8333:Scn2a	UTSW	2	65683847	missense	probably benign	0.01
R8416:Scn2a	UTSW	2	65681001	missense	probably benign	0.00
R8850:Scn2a	UTSW	2	65688386	missense	probably damaging	1.00
R8897:Scn2a	UTSW	2	65715658	critical splice acceptor site	probably null
R8977:Scn2a	UTSW	2	65763670	missense	probably damaging	0.99
R8992:Scn2a	UTSW	2	65763898	missense	probably damaging	1.00
R9190:Scn2a	UTSW	2	65681002	missense	probably benign	0.00
R9206:Scn2a	UTSW	2	65717787	missense	probably damaging	1.00
R9355:Scn2a	UTSW	2	65764089	missense	probably damaging	1.00
R9452:Scn2a	UTSW	2	65764819	missense	probably benign
R9529:Scn2a	UTSW	2	65764588	missense	probably damaging	0.99
R9567:Scn2a	UTSW	2	65688630	missense	probably damaging	1.00
R9569:Scn2a	UTSW	2	65730278	missense	probably damaging	1.00
R9657:Scn2a	UTSW	2	65735688	missense	probably damaging	1.00
R9715:Scn2a	UTSW	2	65748805	missense	possibly damaging	0.93
R9761:Scn2a	UTSW	2	65735686	missense	probably damaging	1.00
Z1176:Scn2a	UTSW	2	65751868	missense	possibly damaging	0.84
Z1177:Scn2a	UTSW	2	65717735	missense	probably benign	0.07

Predicted Primers

PCR Primer
(F):5'- TAGGAAGCATGAGACTCTTGACC -3'
(R):5'- AATGTCAACAGCAGCCTTCAG -3'

Sequencing Primer
(F):5'- TCTTGACCAAGGGAACTGCTG -3'
(R):5'- CAGCCTTCAGGTCAGAGAATG -3'

Posted On

2018-10-18