Incidental Mutation 'R6818:Pgm2'
ID537418
Institutional Source Beutler Lab
Gene Symbol Pgm2
Ensembl Gene ENSMUSG00000025791
Gene Namephosphoglucomutase 2
Synonyms2610020G18Rik, Pgm-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.749) question?
Stock #R6818 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location99929414-99987294 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 99963566 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 220 (I220N)
Ref Sequence ENSEMBL: ENSMUSP00000099844 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058351] [ENSMUST00000102783]
Predicted Effect probably damaging
Transcript: ENSMUST00000058351
AA Change: I202N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000061227
Gene: ENSMUSG00000025791
AA Change: I202N

DomainStartEndE-ValueType
Pfam:PGM_PMM_I 14 158 1.7e-42 PFAM
Pfam:PGM_PMM_II 193 301 3.3e-20 PFAM
Pfam:PGM_PMM_III 306 420 1.1e-33 PFAM
Pfam:PGM_PMM_IV 436 543 1.1e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102783
AA Change: I220N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099844
Gene: ENSMUSG00000025791
AA Change: I220N

DomainStartEndE-ValueType
Pfam:PGM_PMM_I 32 176 2.3e-37 PFAM
Pfam:PGM_PMM_II 211 319 1.2e-19 PFAM
Pfam:PGM_PMM_III 324 438 3.7e-33 PFAM
Pfam:PGM_PMM_IV 455 561 3.6e-8 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 97% (59/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is an isozyme of phosphoglucomutase (PGM) and belongs to the phosphohexose mutase family. There are several PGM isozymes, which are encoded by different genes and catalyze the transfer of phosphate between the 1 and 6 positions of glucose. In most cell types, this PGM isozyme is predominant, representing about 90% of total PGM activity. In red cells, PGM2 is a major isozyme. This gene is highly polymorphic. Mutations in this gene cause glycogen storage disease type 14. Alternativley spliced transcript variants encoding different isoforms have been identified in this gene.[provided by RefSeq, Mar 2010]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 T A 12: 118,901,354 probably null Het
Acot4 A C 12: 84,042,009 E210D probably damaging Het
Adamts9 A C 6: 92,905,191 S476A probably damaging Het
Ak1 T A 2: 32,630,373 M61K probably damaging Het
Ambp G T 4: 63,154,006 S17* probably null Het
Anxa6 T A 11: 54,979,500 M662L probably benign Het
Atp11b T C 3: 35,814,180 I467T possibly damaging Het
B3gat1 G T 9: 26,751,702 probably benign Het
Bccip T G 7: 133,717,759 I193S probably damaging Het
Ccdc170 A G 10: 4,541,782 E401G probably damaging Het
Cldn16 A G 16: 26,477,507 T78A probably damaging Het
Cldn24 G T 8: 47,822,722 A194S probably benign Het
Cltc A G 11: 86,704,228 V1348A possibly damaging Het
Clvs1 T C 4: 9,282,014 probably null Het
Csmd1 C T 8: 16,185,327 D1161N probably damaging Het
Cuzd1 A G 7: 131,316,665 V181A probably damaging Het
Dhx30 A G 9: 110,088,031 I435T probably damaging Het
Dip2b T C 15: 100,193,954 V858A probably benign Het
Dnmt3b C T 2: 153,686,284 T822M probably damaging Het
Dock10 A T 1: 80,615,365 F97I possibly damaging Het
Dock8 T C 19: 25,169,501 probably null Het
Dvl2 T C 11: 70,009,273 L631P probably damaging Het
Faf2 T A 13: 54,641,606 probably null Het
Fat2 T A 11: 55,309,341 H969L probably benign Het
Fsip2 T A 2: 82,985,200 V3759E probably benign Het
Gm10037 A G 13: 67,833,867 Q66R possibly damaging Het
Gm10985 A C 3: 53,845,253 Y19S probably damaging Het
Gm973 T C 1: 59,630,169 L793P probably damaging Het
Gm996 C CTCTA 2: 25,579,721 probably null Het
H2-M1 A G 17: 36,670,435 I236T probably damaging Het
Hif1a A T 12: 73,945,563 R765* probably null Het
Htt A G 5: 34,782,767 K77E probably damaging Het
Ift172 G T 5: 31,265,960 Q826K probably benign Het
Inafm1 C T 7: 16,273,161 A44T probably damaging Het
Kctd4 A G 14: 75,963,308 T240A probably damaging Het
Klk1 A T 7: 44,229,459 I124F probably damaging Het
Kremen1 T C 11: 5,195,051 T442A probably benign Het
Mei4 T A 9: 82,025,521 D202E probably benign Het
Mest T A 6: 30,746,287 D284E probably damaging Het
Nsfl1c T A 2: 151,503,020 Y95* probably null Het
Olfr121 T A 17: 37,752,424 V190D possibly damaging Het
Olfr1282 T G 2: 111,335,314 I255L probably benign Het
Olfr1349 T C 7: 6,514,551 M293V probably damaging Het
Olfr316 T A 11: 58,757,957 C97* probably null Het
Pirt T A 11: 66,925,893 V10E possibly damaging Het
Prl7d1 C A 13: 27,714,471 M19I probably benign Het
Samhd1 T C 2: 157,107,497 N490D probably benign Het
Scn2a C A 2: 65,688,669 S413* probably null Het
Serpinb6e A T 13: 33,832,354 probably null Het
Slitrk5 A G 14: 111,680,294 D450G probably benign Het
Tchh A G 3: 93,443,411 T53A probably damaging Het
Tmem44 A T 16: 30,543,221 probably null Het
Tpm3-rs7 A G 14: 113,315,016 E114G possibly damaging Het
Treml2 A G 17: 48,302,897 Y119C probably damaging Het
Ubxn1 T A 19: 8,873,881 probably null Het
Vmn2r84 A T 10: 130,386,278 M691K probably benign Het
Vmn2r97 A T 17: 18,947,931 I816F possibly damaging Het
Was GCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTC GCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTC X: 8,086,211 probably benign Het
Wfdc2 T C 2: 164,563,150 probably null Het
Zscan4-ps3 T C 7: 11,613,059 S341P probably damaging Het
Other mutations in Pgm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01302:Pgm2 APN 4 99929606 missense probably damaging 1.00
IGL01468:Pgm2 APN 4 99962170 missense possibly damaging 0.82
IGL02013:Pgm2 APN 4 99983961 splice site probably benign
IGL02237:Pgm2 APN 4 99963510 splice site probably benign
IGL02945:Pgm2 APN 4 99961534 missense probably benign
IGL03201:Pgm2 APN 4 99970039 missense probably damaging 0.99
IGL03373:Pgm2 APN 4 99961544 missense probably damaging 1.00
R0349:Pgm2 UTSW 4 99963617 missense probably damaging 1.00
R0683:Pgm2 UTSW 4 99961543 missense probably damaging 0.99
R1650:Pgm2 UTSW 4 99962070 missense possibly damaging 0.70
R1650:Pgm2 UTSW 4 99962079 missense probably benign 0.28
R1741:Pgm2 UTSW 4 99964865 splice site probably null
R1759:Pgm2 UTSW 4 99967108 missense probably damaging 1.00
R1843:Pgm2 UTSW 4 99961478 missense probably damaging 1.00
R3111:Pgm2 UTSW 4 99956025 missense probably benign
R4115:Pgm2 UTSW 4 99962151 nonsense probably null
R4426:Pgm2 UTSW 4 99962140 missense probably benign 0.04
R4748:Pgm2 UTSW 4 99981979 missense probably benign 0.24
R4910:Pgm2 UTSW 4 99963527 missense probably damaging 1.00
R4920:Pgm2 UTSW 4 99986733 missense probably damaging 1.00
R5289:Pgm2 UTSW 4 99967069 missense probably damaging 1.00
R5764:Pgm2 UTSW 4 99964846 missense probably damaging 1.00
R6199:Pgm2 UTSW 4 99978954 missense probably damaging 1.00
R6311:Pgm2 UTSW 4 99970040 missense possibly damaging 0.93
R6600:Pgm2 UTSW 4 99967062 nonsense probably null
R6892:Pgm2 UTSW 4 99929708 missense probably benign
R6984:Pgm2 UTSW 4 99929654 missense probably benign 0.04
R7429:Pgm2 UTSW 4 99955995 start codon destroyed probably null
R7430:Pgm2 UTSW 4 99955995 start codon destroyed probably null
R8017:Pgm2 UTSW 4 99986678 missense probably benign 0.00
R8019:Pgm2 UTSW 4 99986678 missense probably benign 0.00
R8143:Pgm2 UTSW 4 99967218 splice site probably null
R8724:Pgm2 UTSW 4 99929767 missense probably benign 0.00
R8893:Pgm2 UTSW 4 99967100 missense probably damaging 0.99
RF018:Pgm2 UTSW 4 99962303 splice site probably null
Z1176:Pgm2 UTSW 4 99978997 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGACATTTCACAGCTGTCACAG -3'
(R):5'- CTTGCCTACACTGAGGTCTG -3'

Sequencing Primer
(F):5'- ATTTCACAGCTGTCACAGTAGCC -3'
(R):5'- GCCTACACTGAGGTCTGTAAACTG -3'
Posted On2018-10-18