Incidental Mutation 'R6818:Cldn24'
ID537430
Institutional Source Beutler Lab
Gene Symbol Cldn24
Ensembl Gene ENSMUSG00000061974
Gene Nameclaudin 24
SynonymsGm10107
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.147) question?
Stock #R6818 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location47822143-47822805 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 47822722 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 194 (A194S)
Ref Sequence ENSEMBL: ENSMUSP00000078584 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038693] [ENSMUST00000057561] [ENSMUST00000079639]
Predicted Effect probably benign
Transcript: ENSMUST00000038693
SMART Domains Protein: ENSMUSP00000041676
Gene: ENSMUSG00000038064

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 7 183 6.2e-23 PFAM
Pfam:Claudin_2 18 184 1.8e-9 PFAM
low complexity region 185 197 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000057561
SMART Domains Protein: ENSMUSP00000056121
Gene: ENSMUSG00000031563

DomainStartEndE-ValueType
WW 11 43 3.92e-11 SMART
WW 58 90 4.65e-4 SMART
low complexity region 143 156 N/A INTRINSIC
coiled coil region 162 194 N/A INTRINSIC
coiled coil region 223 254 N/A INTRINSIC
coiled coil region 302 333 N/A INTRINSIC
low complexity region 341 358 N/A INTRINSIC
coiled coil region 359 423 N/A INTRINSIC
low complexity region 540 567 N/A INTRINSIC
C2 713 818 5.29e0 SMART
coiled coil region 857 884 N/A INTRINSIC
coiled coil region 1067 1144 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000079639
AA Change: A194S

PolyPhen 2 Score 0.031 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000078584
Gene: ENSMUSG00000061974
AA Change: A194S

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 7 183 9.1e-25 PFAM
Pfam:Claudin_2 18 184 2.2e-12 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 97% (59/61)
MGI Phenotype FUNCTION: This gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. The protein encoded by this gene is 75% identical to the human homolog. Similar to the human gene, this gene is upstream of the Cldn22 gene, which overlaps the Wwc2 gene on the opposite strand. [provided by RefSeq, Aug 2010]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 T A 12: 118,901,354 probably null Het
Acot4 A C 12: 84,042,009 E210D probably damaging Het
Adamts9 A C 6: 92,905,191 S476A probably damaging Het
Ak1 T A 2: 32,630,373 M61K probably damaging Het
Ambp G T 4: 63,154,006 S17* probably null Het
Anxa6 T A 11: 54,979,500 M662L probably benign Het
Atp11b T C 3: 35,814,180 I467T possibly damaging Het
B3gat1 G T 9: 26,751,702 probably benign Het
Bccip T G 7: 133,717,759 I193S probably damaging Het
Ccdc170 A G 10: 4,541,782 E401G probably damaging Het
Cldn16 A G 16: 26,477,507 T78A probably damaging Het
Cltc A G 11: 86,704,228 V1348A possibly damaging Het
Clvs1 T C 4: 9,282,014 probably null Het
Csmd1 C T 8: 16,185,327 D1161N probably damaging Het
Cuzd1 A G 7: 131,316,665 V181A probably damaging Het
Dhx30 A G 9: 110,088,031 I435T probably damaging Het
Dip2b T C 15: 100,193,954 V858A probably benign Het
Dnmt3b C T 2: 153,686,284 T822M probably damaging Het
Dock10 A T 1: 80,615,365 F97I possibly damaging Het
Dock8 T C 19: 25,169,501 probably null Het
Dvl2 T C 11: 70,009,273 L631P probably damaging Het
Faf2 T A 13: 54,641,606 probably null Het
Fat2 T A 11: 55,309,341 H969L probably benign Het
Fsip2 T A 2: 82,985,200 V3759E probably benign Het
Gm10037 A G 13: 67,833,867 Q66R possibly damaging Het
Gm10985 A C 3: 53,845,253 Y19S probably damaging Het
Gm973 T C 1: 59,630,169 L793P probably damaging Het
Gm996 C CTCTA 2: 25,579,721 probably null Het
H2-M1 A G 17: 36,670,435 I236T probably damaging Het
Hif1a A T 12: 73,945,563 R765* probably null Het
Htt A G 5: 34,782,767 K77E probably damaging Het
Ift172 G T 5: 31,265,960 Q826K probably benign Het
Inafm1 C T 7: 16,273,161 A44T probably damaging Het
Kctd4 A G 14: 75,963,308 T240A probably damaging Het
Klk1 A T 7: 44,229,459 I124F probably damaging Het
Kremen1 T C 11: 5,195,051 T442A probably benign Het
Mei4 T A 9: 82,025,521 D202E probably benign Het
Mest T A 6: 30,746,287 D284E probably damaging Het
Nsfl1c T A 2: 151,503,020 Y95* probably null Het
Olfr121 T A 17: 37,752,424 V190D possibly damaging Het
Olfr1282 T G 2: 111,335,314 I255L probably benign Het
Olfr1349 T C 7: 6,514,551 M293V probably damaging Het
Olfr316 T A 11: 58,757,957 C97* probably null Het
Pgm2 T A 4: 99,963,566 I220N probably damaging Het
Pirt T A 11: 66,925,893 V10E possibly damaging Het
Prl7d1 C A 13: 27,714,471 M19I probably benign Het
Samhd1 T C 2: 157,107,497 N490D probably benign Het
Scn2a C A 2: 65,688,669 S413* probably null Het
Serpinb6e A T 13: 33,832,354 probably null Het
Slitrk5 A G 14: 111,680,294 D450G probably benign Het
Tchh A G 3: 93,443,411 T53A probably damaging Het
Tmem44 A T 16: 30,543,221 probably null Het
Tpm3-rs7 A G 14: 113,315,016 E114G possibly damaging Het
Treml2 A G 17: 48,302,897 Y119C probably damaging Het
Ubxn1 T A 19: 8,873,881 probably null Het
Vmn2r84 A T 10: 130,386,278 M691K probably benign Het
Vmn2r97 A T 17: 18,947,931 I816F possibly damaging Het
Was GCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTC GCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTC X: 8,086,211 probably benign Het
Wfdc2 T C 2: 164,563,150 probably null Het
Zscan4-ps3 T C 7: 11,613,059 S341P probably damaging Het
Other mutations in Cldn24
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2252:Cldn24 UTSW 8 47822328 missense probably benign 0.44
R2253:Cldn24 UTSW 8 47822328 missense probably benign 0.44
R2309:Cldn24 UTSW 8 47822739 nonsense probably null
R6265:Cldn24 UTSW 8 47822339 missense probably benign 0.00
R7688:Cldn24 UTSW 8 47822705 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCATGGTGCTAGTTCCTGTC -3'
(R):5'- TTGGACAATCCCCAGCATAC -3'

Sequencing Primer
(F):5'- GCTAGTTCCTGTCTCCTGGG -3'
(R):5'- TTTCCACACATAGCTATGCAATG -3'
Posted On2018-10-18