Incidental Mutation 'R6818:Anxa6'
ID 537437
Institutional Source Beutler Lab
Gene Symbol Anxa6
Ensembl Gene ENSMUSG00000018340
Gene Name annexin A6
Synonyms AnxVI, Anx6, Cabm, Camb, Annexin VI
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.122) question?
Stock # R6818 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 54979108-55033445 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 54979500 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 662 (M662L)
Ref Sequence ENSEMBL: ENSMUSP00000104511 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102727] [ENSMUST00000108883]
AlphaFold P14824
Predicted Effect probably benign
Transcript: ENSMUST00000102727
AA Change: M656L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099788
Gene: ENSMUSG00000018340
AA Change: M656L

DomainStartEndE-ValueType
ANX 37 89 4.03e-19 SMART
ANX 109 161 2.09e-26 SMART
ANX 193 245 1.55e-20 SMART
ANX 268 320 2.23e-21 SMART
ANX 380 432 9.47e-25 SMART
ANX 452 504 1.12e-26 SMART
ANX 535 587 7.77e-12 SMART
ANX 610 662 4.73e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108883
AA Change: M662L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104511
Gene: ENSMUSG00000018340
AA Change: M662L

DomainStartEndE-ValueType
ANX 37 89 4.03e-19 SMART
ANX 109 161 2.09e-26 SMART
ANX 193 245 1.55e-20 SMART
ANX 268 320 2.23e-21 SMART
ANX 380 432 9.47e-25 SMART
ANX 452 504 1.12e-26 SMART
low complexity region 517 528 N/A INTRINSIC
ANX 541 593 7.77e-12 SMART
ANX 616 668 4.73e-25 SMART
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 97% (59/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Annexin VI belongs to a family of calcium-dependent membrane and phospholipid binding proteins. Several members of the annexin family have been implicated in membrane-related events along exocytotic and endocytotic pathways. The annexin VI gene is approximately 60 kbp long and contains 26 exons. It encodes a protein of about 68 kDa that consists of eight 68-amino acid repeats separated by linking sequences of variable lengths. It is highly similar to human annexins I and II sequences, each of which contain four such repeats. Annexin VI has been implicated in mediating the endosome aggregation and vesicle fusion in secreting epithelia during exocytosis. Alternatively spliced transcript variants have been described. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a knock-out allele have normal immunological development but exhibit altered cardiomyocyte mechanics and intracellular calcium signaling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 T A 12: 118,901,354 probably null Het
Acot4 A C 12: 84,042,009 E210D probably damaging Het
Adamts9 A C 6: 92,905,191 S476A probably damaging Het
Ak1 T A 2: 32,630,373 M61K probably damaging Het
Ambp G T 4: 63,154,006 S17* probably null Het
Atp11b T C 3: 35,814,180 I467T possibly damaging Het
B3gat1 G T 9: 26,751,702 probably benign Het
Bccip T G 7: 133,717,759 I193S probably damaging Het
Ccdc170 A G 10: 4,541,782 E401G probably damaging Het
Cldn16 A G 16: 26,477,507 T78A probably damaging Het
Cldn24 G T 8: 47,822,722 A194S probably benign Het
Cltc A G 11: 86,704,228 V1348A possibly damaging Het
Clvs1 T C 4: 9,282,014 probably null Het
Csmd1 C T 8: 16,185,327 D1161N probably damaging Het
Cuzd1 A G 7: 131,316,665 V181A probably damaging Het
Dhx30 A G 9: 110,088,031 I435T probably damaging Het
Dip2b T C 15: 100,193,954 V858A probably benign Het
Dnmt3b C T 2: 153,686,284 T822M probably damaging Het
Dock10 A T 1: 80,615,365 F97I possibly damaging Het
Dock8 T C 19: 25,169,501 probably null Het
Dvl2 T C 11: 70,009,273 L631P probably damaging Het
Faf2 T A 13: 54,641,606 probably null Het
Fat2 T A 11: 55,309,341 H969L probably benign Het
Fsip2 T A 2: 82,985,200 V3759E probably benign Het
Gm10037 A G 13: 67,833,867 Q66R possibly damaging Het
Gm10985 A C 3: 53,845,253 Y19S probably damaging Het
Gm973 T C 1: 59,630,169 L793P probably damaging Het
Gm996 C CTCTA 2: 25,579,721 probably null Het
H2-M1 A G 17: 36,670,435 I236T probably damaging Het
Hif1a A T 12: 73,945,563 R765* probably null Het
Htt A G 5: 34,782,767 K77E probably damaging Het
Ift172 G T 5: 31,265,960 Q826K probably benign Het
Inafm1 C T 7: 16,273,161 A44T probably damaging Het
Kctd4 A G 14: 75,963,308 T240A probably damaging Het
Klk1 A T 7: 44,229,459 I124F probably damaging Het
Kremen1 T C 11: 5,195,051 T442A probably benign Het
Mei4 T A 9: 82,025,521 D202E probably benign Het
Mest T A 6: 30,746,287 D284E probably damaging Het
Nsfl1c T A 2: 151,503,020 Y95* probably null Het
Olfr121 T A 17: 37,752,424 V190D possibly damaging Het
Olfr1282 T G 2: 111,335,314 I255L probably benign Het
Olfr1349 T C 7: 6,514,551 M293V probably damaging Het
Olfr316 T A 11: 58,757,957 C97* probably null Het
Pgm2 T A 4: 99,963,566 I220N probably damaging Het
Pirt T A 11: 66,925,893 V10E possibly damaging Het
Prl7d1 C A 13: 27,714,471 M19I probably benign Het
Samhd1 T C 2: 157,107,497 N490D probably benign Het
Scn2a C A 2: 65,688,669 S413* probably null Het
Serpinb6e A T 13: 33,832,354 probably null Het
Slitrk5 A G 14: 111,680,294 D450G probably benign Het
Tchh A G 3: 93,443,411 T53A probably damaging Het
Tmem44 A T 16: 30,543,221 probably null Het
Tpm3-rs7 A G 14: 113,315,016 E114G possibly damaging Het
Treml2 A G 17: 48,302,897 Y119C probably damaging Het
Ubxn1 T A 19: 8,873,881 probably null Het
Vmn2r84 A T 10: 130,386,278 M691K probably benign Het
Vmn2r97 A T 17: 18,947,931 I816F possibly damaging Het
Was GCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTC GCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTC X: 8,086,211 probably benign Het
Wfdc2 T C 2: 164,563,150 probably null Het
Zscan4-ps3 T C 7: 11,613,059 S341P probably damaging Het
Other mutations in Anxa6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01420:Anxa6 APN 11 54992363 missense probably damaging 1.00
IGL02450:Anxa6 APN 11 54994941 missense probably damaging 1.00
R0220:Anxa6 UTSW 11 54981762 splice site probably null
R0374:Anxa6 UTSW 11 55005828 missense probably benign 0.02
R0599:Anxa6 UTSW 11 54979466 missense possibly damaging 0.92
R0659:Anxa6 UTSW 11 54983347 missense probably damaging 0.99
R0924:Anxa6 UTSW 11 54994388 splice site probably null
R0930:Anxa6 UTSW 11 54994388 splice site probably null
R1005:Anxa6 UTSW 11 55001218 missense possibly damaging 0.89
R1435:Anxa6 UTSW 11 54991410 missense probably benign
R2314:Anxa6 UTSW 11 55011735 missense probably damaging 1.00
R2850:Anxa6 UTSW 11 55011026 missense possibly damaging 0.94
R4596:Anxa6 UTSW 11 54994583 splice site probably null
R5057:Anxa6 UTSW 11 55001236 missense possibly damaging 0.82
R5685:Anxa6 UTSW 11 54996370 missense probably benign
R5968:Anxa6 UTSW 11 54994341 missense probably damaging 1.00
R6145:Anxa6 UTSW 11 54994904 missense probably damaging 0.98
R6268:Anxa6 UTSW 11 54987077 splice site probably null
R6864:Anxa6 UTSW 11 54986185 missense probably benign
R7224:Anxa6 UTSW 11 54986167 missense probably damaging 1.00
R7595:Anxa6 UTSW 11 54985085 missense probably benign 0.00
R7740:Anxa6 UTSW 11 55007899 missense probably damaging 1.00
R8084:Anxa6 UTSW 11 55004008 missense probably damaging 1.00
R8507:Anxa6 UTSW 11 55013870 missense probably benign 0.14
R8676:Anxa6 UTSW 11 55001282 nonsense probably null
R8818:Anxa6 UTSW 11 55011752 missense possibly damaging 0.93
R9226:Anxa6 UTSW 11 54994965 missense probably benign 0.34
R9227:Anxa6 UTSW 11 55007868 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AGTATATGGCCGTGGTTCACC -3'
(R):5'- TCACAAGTGTGTCTGGCGAG -3'

Sequencing Primer
(F):5'- ACCCTCAATGGCTAGAGAGTGC -3'
(R):5'- GAGGTCTCTCTAGCCTTGATACAG -3'
Posted On 2018-10-18