Incidental Mutation 'R6818:Slitrk5'
ID537451
Institutional Source Beutler Lab
Gene Symbol Slitrk5
Ensembl Gene ENSMUSG00000033214
Gene NameSLIT and NTRK-like family, member 5
Synonyms2610019D03Rik
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_198865.1; MGI:2679448

Is this an essential gene? Possibly non essential (E-score: 0.451) question?
Stock #R6818 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location111675097-111683141 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 111680294 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 450 (D450G)
Ref Sequence ENSEMBL: ENSMUSP00000041499 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042767] [ENSMUST00000227891]
Predicted Effect probably benign
Transcript: ENSMUST00000042767
AA Change: D450G

PolyPhen 2 Score 0.324 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000041499
Gene: ENSMUSG00000033214
AA Change: D450G

DomainStartEndE-ValueType
Blast:LRRNT 47 85 3e-18 BLAST
low complexity region 86 96 N/A INTRINSIC
LRR 108 127 2.76e2 SMART
LRR_TYP 128 151 1.67e-2 SMART
LRR 152 175 2.67e-1 SMART
LRR 176 199 1.08e-1 SMART
LRR 202 223 7.38e1 SMART
LRRCT 235 285 2.13e-5 SMART
low complexity region 308 323 N/A INTRINSIC
LRRNT 373 410 9.53e-2 SMART
LRR 433 455 1.45e1 SMART
LRR_TYP 456 479 4.94e-5 SMART
LRR_TYP 480 503 7.78e-3 SMART
LRR_TYP 504 527 2.43e-4 SMART
LRR 528 551 1.86e2 SMART
LRRCT 563 613 3.59e-3 SMART
low complexity region 618 632 N/A INTRINSIC
transmembrane domain 666 688 N/A INTRINSIC
low complexity region 794 816 N/A INTRINSIC
low complexity region 818 823 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000227891
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 97% (59/61)
MGI Phenotype Strain: 4459459
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the SLITRK family, such as SLITRK5, are integral membrane proteins with 2 N-terminal leucine-rich repeat (LRR) domains similar to those of SLIT proteins (see SLIT1; MIM 603742). Most SLITRKs, including SLITRK5, also have C-terminal regions that share homology with neurotrophin receptors (see NTRK1; MIM 191315). SLITRKs are expressed predominantly in neural tissues and have neurite-modulating activity (Aruga et al., 2003 [PubMed 14557068]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null allele have abnormal medium spiny neuron morphology and exhibit behavioral abnormalities. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted(3)

Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 T A 12: 118,901,354 probably null Het
Acot4 A C 12: 84,042,009 E210D probably damaging Het
Adamts9 A C 6: 92,905,191 S476A probably damaging Het
Ak1 T A 2: 32,630,373 M61K probably damaging Het
Ambp G T 4: 63,154,006 S17* probably null Het
Anxa6 T A 11: 54,979,500 M662L probably benign Het
Atp11b T C 3: 35,814,180 I467T possibly damaging Het
B3gat1 G T 9: 26,751,702 probably benign Het
Bccip T G 7: 133,717,759 I193S probably damaging Het
Ccdc170 A G 10: 4,541,782 E401G probably damaging Het
Cldn16 A G 16: 26,477,507 T78A probably damaging Het
Cldn24 G T 8: 47,822,722 A194S probably benign Het
Cltc A G 11: 86,704,228 V1348A possibly damaging Het
Clvs1 T C 4: 9,282,014 probably null Het
Csmd1 C T 8: 16,185,327 D1161N probably damaging Het
Cuzd1 A G 7: 131,316,665 V181A probably damaging Het
Dhx30 A G 9: 110,088,031 I435T probably damaging Het
Dip2b T C 15: 100,193,954 V858A probably benign Het
Dnmt3b C T 2: 153,686,284 T822M probably damaging Het
Dock10 A T 1: 80,615,365 F97I possibly damaging Het
Dock8 T C 19: 25,169,501 probably null Het
Dvl2 T C 11: 70,009,273 L631P probably damaging Het
Faf2 T A 13: 54,641,606 probably null Het
Fat2 T A 11: 55,309,341 H969L probably benign Het
Fsip2 T A 2: 82,985,200 V3759E probably benign Het
Gm10037 A G 13: 67,833,867 Q66R possibly damaging Het
Gm10985 A C 3: 53,845,253 Y19S probably damaging Het
Gm973 T C 1: 59,630,169 L793P probably damaging Het
Gm996 C CTCTA 2: 25,579,721 probably null Het
H2-M1 A G 17: 36,670,435 I236T probably damaging Het
Hif1a A T 12: 73,945,563 R765* probably null Het
Htt A G 5: 34,782,767 K77E probably damaging Het
Ift172 G T 5: 31,265,960 Q826K probably benign Het
Inafm1 C T 7: 16,273,161 A44T probably damaging Het
Kctd4 A G 14: 75,963,308 T240A probably damaging Het
Klk1 A T 7: 44,229,459 I124F probably damaging Het
Kremen1 T C 11: 5,195,051 T442A probably benign Het
Mei4 T A 9: 82,025,521 D202E probably benign Het
Mest T A 6: 30,746,287 D284E probably damaging Het
Nsfl1c T A 2: 151,503,020 Y95* probably null Het
Olfr121 T A 17: 37,752,424 V190D possibly damaging Het
Olfr1282 T G 2: 111,335,314 I255L probably benign Het
Olfr1349 T C 7: 6,514,551 M293V probably damaging Het
Olfr316 T A 11: 58,757,957 C97* probably null Het
Pgm2 T A 4: 99,963,566 I220N probably damaging Het
Pirt T A 11: 66,925,893 V10E possibly damaging Het
Prl7d1 C A 13: 27,714,471 M19I probably benign Het
Samhd1 T C 2: 157,107,497 N490D probably benign Het
Scn2a C A 2: 65,688,669 S413* probably null Het
Serpinb6e A T 13: 33,832,354 probably null Het
Tchh A G 3: 93,443,411 T53A probably damaging Het
Tmem44 A T 16: 30,543,221 probably null Het
Tpm3-rs7 A G 14: 113,315,016 E114G possibly damaging Het
Treml2 A G 17: 48,302,897 Y119C probably damaging Het
Ubxn1 T A 19: 8,873,881 probably null Het
Vmn2r84 A T 10: 130,386,278 M691K probably benign Het
Vmn2r97 A T 17: 18,947,931 I816F possibly damaging Het
Was GCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTC GCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTC X: 8,086,211 Het
Wfdc2 T C 2: 164,563,150 probably null Het
Zscan4-ps3 T C 7: 11,613,059 S341P probably damaging Het
Other mutations in Slitrk5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00801:Slitrk5 APN 14 111680665 missense probably benign 0.05
IGL01624:Slitrk5 APN 14 111681094 missense probably damaging 1.00
IGL01680:Slitrk5 APN 14 111679000 missense probably benign 0.23
IGL03234:Slitrk5 APN 14 111679285 missense probably benign 0.00
P0019:Slitrk5 UTSW 14 111680594 missense possibly damaging 0.88
R0323:Slitrk5 UTSW 14 111681623 missense probably damaging 0.99
R0334:Slitrk5 UTSW 14 111680824 missense probably benign
R0392:Slitrk5 UTSW 14 111679033 missense probably benign 0.06
R0659:Slitrk5 UTSW 14 111680689 missense probably benign 0.00
R1344:Slitrk5 UTSW 14 111680389 missense probably benign 0.04
R1754:Slitrk5 UTSW 14 111680519 missense probably damaging 1.00
R1983:Slitrk5 UTSW 14 111680389 missense probably benign 0.04
R2070:Slitrk5 UTSW 14 111680189 missense probably damaging 0.99
R2071:Slitrk5 UTSW 14 111680189 missense probably damaging 0.99
R3001:Slitrk5 UTSW 14 111679582 missense probably damaging 1.00
R3002:Slitrk5 UTSW 14 111679582 missense probably damaging 1.00
R3003:Slitrk5 UTSW 14 111679582 missense probably damaging 1.00
R3885:Slitrk5 UTSW 14 111679797 nonsense probably null
R3886:Slitrk5 UTSW 14 111679797 nonsense probably null
R3888:Slitrk5 UTSW 14 111679797 nonsense probably null
R4962:Slitrk5 UTSW 14 111681247 missense probably benign 0.02
R4999:Slitrk5 UTSW 14 111680216 missense probably damaging 0.99
R5036:Slitrk5 UTSW 14 111680884 missense possibly damaging 0.87
R5190:Slitrk5 UTSW 14 111679420 missense probably damaging 1.00
R5237:Slitrk5 UTSW 14 111681686 missense possibly damaging 0.94
R5669:Slitrk5 UTSW 14 111681623 missense probably damaging 0.99
R5793:Slitrk5 UTSW 14 111679913 missense probably damaging 1.00
R5839:Slitrk5 UTSW 14 111679598 missense probably benign 0.00
R6083:Slitrk5 UTSW 14 111681725 missense probably benign 0.01
R6224:Slitrk5 UTSW 14 111679816 unclassified probably benign
R6225:Slitrk5 UTSW 14 111679816 unclassified probably benign
R6230:Slitrk5 UTSW 14 111679816 unclassified probably benign
R6337:Slitrk5 UTSW 14 111680252 missense probably damaging 0.96
R6666:Slitrk5 UTSW 14 111680102 missense probably damaging 0.96
R6895:Slitrk5 UTSW 14 111681653 missense probably damaging 1.00
R7094:Slitrk5 UTSW 14 111680836 missense probably benign 0.02
R7385:Slitrk5 UTSW 14 111680699 missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- TGGAATGTCCTACAGCATGTAC -3'
(R):5'- TTGGGACGGGATCAAAAGTC -3'

Sequencing Primer
(F):5'- GGGTCTCAATGTCAACTGCCAAG -3'
(R):5'- GGGATCAAAAGTCCCAGCCTG -3'
Posted On2018-10-18