Incidental Mutation 'R6818:Dip2b'
ID 537453
Institutional Source Beutler Lab
Gene Symbol Dip2b
Ensembl Gene ENSMUSG00000023026
Gene Name disco interacting protein 2 homolog B
Synonyms
MMRRC Submission
Accession Numbers
Essential gene? Possibly essential (E-score: 0.709) question?
Stock # R6818 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 100038664-100219473 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 100193954 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 858 (V858A)
Ref Sequence ENSEMBL: ENSMUSP00000023768 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023768] [ENSMUST00000100203]
AlphaFold Q3UH60
Predicted Effect probably benign
Transcript: ENSMUST00000023768
AA Change: V858A

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000023768
Gene: ENSMUSG00000023026
AA Change: V858A

DomainStartEndE-ValueType
Pfam:AMP-binding 109 584 9.5e-26 PFAM
Pfam:AMP-binding 760 1235 1.2e-52 PFAM
low complexity region 1299 1311 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100203
AA Change: V1092A

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000097777
Gene: ENSMUSG00000023026
AA Change: V1092A

DomainStartEndE-ValueType
DMAP_binding 12 130 1e-42 SMART
low complexity region 152 168 N/A INTRINSIC
low complexity region 181 192 N/A INTRINSIC
Pfam:AMP-binding 341 817 2e-26 PFAM
Pfam:AMP-binding 993 1468 1.8e-64 PFAM
low complexity region 1532 1544 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 97% (59/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disco-interacting protein homolog 2 protein family. The encoded protein contains a binding site for the transcriptional regulator DNA methyltransferase 1 associated protein 1 as well as AMP-binding sites. The presence of these sites suggests that the encoded protein may participate in DNA methylation. This gene is located near a folate-sensitive fragile site, and CGG-repeat expansion in the promoter of this gene which affects transcription has been detected in individuals containing this fragile site on chromosome 12. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 T A 12: 118,901,354 probably null Het
Acot4 A C 12: 84,042,009 E210D probably damaging Het
Adamts9 A C 6: 92,905,191 S476A probably damaging Het
Ak1 T A 2: 32,630,373 M61K probably damaging Het
Ambp G T 4: 63,154,006 S17* probably null Het
Anxa6 T A 11: 54,979,500 M662L probably benign Het
Atp11b T C 3: 35,814,180 I467T possibly damaging Het
B3gat1 G T 9: 26,751,702 probably benign Het
Bccip T G 7: 133,717,759 I193S probably damaging Het
Ccdc170 A G 10: 4,541,782 E401G probably damaging Het
Cldn16 A G 16: 26,477,507 T78A probably damaging Het
Cldn24 G T 8: 47,822,722 A194S probably benign Het
Cltc A G 11: 86,704,228 V1348A possibly damaging Het
Clvs1 T C 4: 9,282,014 probably null Het
Csmd1 C T 8: 16,185,327 D1161N probably damaging Het
Cuzd1 A G 7: 131,316,665 V181A probably damaging Het
Dhx30 A G 9: 110,088,031 I435T probably damaging Het
Dnmt3b C T 2: 153,686,284 T822M probably damaging Het
Dock10 A T 1: 80,615,365 F97I possibly damaging Het
Dock8 T C 19: 25,169,501 probably null Het
Dvl2 T C 11: 70,009,273 L631P probably damaging Het
Faf2 T A 13: 54,641,606 probably null Het
Fat2 T A 11: 55,309,341 H969L probably benign Het
Fsip2 T A 2: 82,985,200 V3759E probably benign Het
Gm10037 A G 13: 67,833,867 Q66R possibly damaging Het
Gm10985 A C 3: 53,845,253 Y19S probably damaging Het
Gm973 T C 1: 59,630,169 L793P probably damaging Het
Gm996 C CTCTA 2: 25,579,721 probably null Het
H2-M1 A G 17: 36,670,435 I236T probably damaging Het
Hif1a A T 12: 73,945,563 R765* probably null Het
Htt A G 5: 34,782,767 K77E probably damaging Het
Ift172 G T 5: 31,265,960 Q826K probably benign Het
Inafm1 C T 7: 16,273,161 A44T probably damaging Het
Kctd4 A G 14: 75,963,308 T240A probably damaging Het
Klk1 A T 7: 44,229,459 I124F probably damaging Het
Kremen1 T C 11: 5,195,051 T442A probably benign Het
Mei4 T A 9: 82,025,521 D202E probably benign Het
Mest T A 6: 30,746,287 D284E probably damaging Het
Nsfl1c T A 2: 151,503,020 Y95* probably null Het
Olfr121 T A 17: 37,752,424 V190D possibly damaging Het
Olfr1282 T G 2: 111,335,314 I255L probably benign Het
Olfr1349 T C 7: 6,514,551 M293V probably damaging Het
Olfr316 T A 11: 58,757,957 C97* probably null Het
Pgm2 T A 4: 99,963,566 I220N probably damaging Het
Pirt T A 11: 66,925,893 V10E possibly damaging Het
Prl7d1 C A 13: 27,714,471 M19I probably benign Het
Samhd1 T C 2: 157,107,497 N490D probably benign Het
Scn2a C A 2: 65,688,669 S413* probably null Het
Serpinb6e A T 13: 33,832,354 probably null Het
Slitrk5 A G 14: 111,680,294 D450G probably benign Het
Tchh A G 3: 93,443,411 T53A probably damaging Het
Tmem44 A T 16: 30,543,221 probably null Het
Tpm3-rs7 A G 14: 113,315,016 E114G possibly damaging Het
Treml2 A G 17: 48,302,897 Y119C probably damaging Het
Ubxn1 T A 19: 8,873,881 probably null Het
Vmn2r84 A T 10: 130,386,278 M691K probably benign Het
Vmn2r97 A T 17: 18,947,931 I816F possibly damaging Het
Was GCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTC GCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTC X: 8,086,211 probably benign Het
Wfdc2 T C 2: 164,563,150 probably null Het
Zscan4-ps3 T C 7: 11,613,059 S341P probably damaging Het
Other mutations in Dip2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Dip2b APN 15 100174501 missense probably damaging 1.00
IGL01716:Dip2b APN 15 100209636 missense probably benign 0.00
IGL01893:Dip2b APN 15 100171220 splice site probably benign
IGL01915:Dip2b APN 15 100178511 missense probably damaging 1.00
IGL02125:Dip2b APN 15 100186250 missense possibly damaging 0.60
IGL02200:Dip2b APN 15 100151202 missense possibly damaging 0.93
IGL02506:Dip2b APN 15 100157281 missense probably damaging 1.00
IGL02571:Dip2b APN 15 100157885 missense possibly damaging 0.93
IGL02706:Dip2b APN 15 100215311 missense probably damaging 0.98
IGL02983:Dip2b APN 15 100132022 missense possibly damaging 0.81
IGL03120:Dip2b APN 15 100203127 splice site probably benign
IGL03181:Dip2b APN 15 100215207 missense probably damaging 0.98
IGL03229:Dip2b APN 15 100207838 splice site probably benign
IGL03399:Dip2b APN 15 100175327 missense possibly damaging 0.63
PIT4131001:Dip2b UTSW 15 100202352 missense probably damaging 1.00
R0009:Dip2b UTSW 15 100169312 missense probably damaging 1.00
R0058:Dip2b UTSW 15 100215240 missense probably benign 0.03
R0058:Dip2b UTSW 15 100215240 missense probably benign 0.03
R0092:Dip2b UTSW 15 100202265 missense probably damaging 1.00
R0201:Dip2b UTSW 15 100186147 missense probably damaging 0.98
R0359:Dip2b UTSW 15 100211993 missense probably damaging 0.98
R0390:Dip2b UTSW 15 100193913 missense probably damaging 0.99
R0564:Dip2b UTSW 15 100162719 nonsense probably null
R0730:Dip2b UTSW 15 100171651 missense probably damaging 1.00
R1144:Dip2b UTSW 15 100154250 missense probably benign 0.11
R1200:Dip2b UTSW 15 100209745 missense probably benign 0.00
R1506:Dip2b UTSW 15 100183113 missense probably damaging 1.00
R1750:Dip2b UTSW 15 100178466 missense probably benign
R1760:Dip2b UTSW 15 100212029 missense probably damaging 1.00
R1773:Dip2b UTSW 15 100193961 missense probably benign 0.00
R1812:Dip2b UTSW 15 100198938 splice site probably null
R2264:Dip2b UTSW 15 100203216 missense probably benign 0.05
R3105:Dip2b UTSW 15 100142137 nonsense probably null
R4029:Dip2b UTSW 15 100186172 missense probably damaging 1.00
R4030:Dip2b UTSW 15 100186172 missense probably damaging 1.00
R4296:Dip2b UTSW 15 100181336 missense probably benign
R4392:Dip2b UTSW 15 100162036 missense probably damaging 1.00
R4480:Dip2b UTSW 15 100186301 missense probably damaging 0.99
R4564:Dip2b UTSW 15 100157258 nonsense probably null
R4605:Dip2b UTSW 15 100209636 missense probably benign 0.00
R4606:Dip2b UTSW 15 100215329 missense possibly damaging 0.91
R4634:Dip2b UTSW 15 100160491 missense probably damaging 1.00
R4667:Dip2b UTSW 15 100151360 missense probably benign 0.01
R4739:Dip2b UTSW 15 100207777 missense probably damaging 0.98
R4826:Dip2b UTSW 15 100169281 missense probably damaging 0.99
R4870:Dip2b UTSW 15 100195784 splice site probably null
R4877:Dip2b UTSW 15 100160529 missense possibly damaging 0.49
R4932:Dip2b UTSW 15 100171722 missense probably damaging 1.00
R5009:Dip2b UTSW 15 100195784 splice site probably null
R5169:Dip2b UTSW 15 100205113 missense probably damaging 1.00
R5216:Dip2b UTSW 15 100211986 missense probably damaging 1.00
R5218:Dip2b UTSW 15 100154296 missense probably benign 0.00
R5274:Dip2b UTSW 15 100212104 missense possibly damaging 0.54
R5370:Dip2b UTSW 15 100211986 missense probably damaging 1.00
R5420:Dip2b UTSW 15 100205173 intron probably benign
R5447:Dip2b UTSW 15 100211986 missense probably damaging 1.00
R5670:Dip2b UTSW 15 100190104 missense possibly damaging 0.80
R5768:Dip2b UTSW 15 100157945 missense probably benign 0.32
R5908:Dip2b UTSW 15 100151184 missense possibly damaging 0.93
R5957:Dip2b UTSW 15 100209694 missense probably benign 0.03
R5987:Dip2b UTSW 15 100190079 missense probably damaging 1.00
R6260:Dip2b UTSW 15 100162702 missense probably benign 0.05
R6325:Dip2b UTSW 15 100154282 missense probably benign 0.00
R6367:Dip2b UTSW 15 100115914 missense possibly damaging 0.50
R6391:Dip2b UTSW 15 100151276 missense probably damaging 1.00
R6422:Dip2b UTSW 15 100199011 missense probably damaging 0.98
R6922:Dip2b UTSW 15 100193843 missense probably benign 0.25
R7002:Dip2b UTSW 15 100160465 missense probably benign 0.43
R7076:Dip2b UTSW 15 100157972 splice site probably null
R7176:Dip2b UTSW 15 100169318 missense probably damaging 1.00
R7255:Dip2b UTSW 15 100209627 missense probably benign 0.00
R7463:Dip2b UTSW 15 100154157 missense probably benign
R7513:Dip2b UTSW 15 100207748 splice site probably null
R7876:Dip2b UTSW 15 100191041 missense probably benign 0.02
R8368:Dip2b UTSW 15 100154243 missense probably benign 0.00
R9289:Dip2b UTSW 15 100173271 missense probably damaging 0.97
R9405:Dip2b UTSW 15 100195876 missense probably benign 0.05
R9477:Dip2b UTSW 15 100038903 missense probably damaging 1.00
R9485:Dip2b UTSW 15 100155043 missense probably benign 0.05
R9533:Dip2b UTSW 15 100175297 missense probably benign 0.06
R9581:Dip2b UTSW 15 100181374 missense probably damaging 0.99
R9666:Dip2b UTSW 15 100209580 missense probably damaging 1.00
X0064:Dip2b UTSW 15 100115850 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATGCAGCCCACATGTCACC -3'
(R):5'- TGCATGAGTGTTCACAGCC -3'

Sequencing Primer
(F):5'- AGCCCACATGTCACCTGGTTG -3'
(R):5'- ATGAGTGTTCACAGCCCCTGC -3'
Posted On 2018-10-18