Incidental Mutation 'R6818:Dip2b'
ID 537453
Institutional Source Beutler Lab
Gene Symbol Dip2b
Ensembl Gene ENSMUSG00000023026
Gene Name disco interacting protein 2 homolog B
Synonyms
MMRRC Submission 044930-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.615) question?
Stock # R6818 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 99936545-100117354 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 100091835 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 858 (V858A)
Ref Sequence ENSEMBL: ENSMUSP00000023768 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023768] [ENSMUST00000100203]
AlphaFold Q3UH60
Predicted Effect probably benign
Transcript: ENSMUST00000023768
AA Change: V858A

PolyPhen 2 Score 0.090 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000023768
Gene: ENSMUSG00000023026
AA Change: V858A

DomainStartEndE-ValueType
Pfam:AMP-binding 109 584 9.5e-26 PFAM
Pfam:AMP-binding 760 1235 1.2e-52 PFAM
low complexity region 1299 1311 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100203
AA Change: V1092A

PolyPhen 2 Score 0.075 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000097777
Gene: ENSMUSG00000023026
AA Change: V1092A

DomainStartEndE-ValueType
DMAP_binding 12 130 1e-42 SMART
low complexity region 152 168 N/A INTRINSIC
low complexity region 181 192 N/A INTRINSIC
Pfam:AMP-binding 341 817 2e-26 PFAM
Pfam:AMP-binding 993 1468 1.8e-64 PFAM
low complexity region 1532 1544 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 97% (59/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disco-interacting protein homolog 2 protein family. The encoded protein contains a binding site for the transcriptional regulator DNA methyltransferase 1 associated protein 1 as well as AMP-binding sites. The presence of these sites suggests that the encoded protein may participate in DNA methylation. This gene is located near a folate-sensitive fragile site, and CGG-repeat expansion in the promoter of this gene which affects transcription has been detected in individuals containing this fragile site on chromosome 12. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 T A 12: 118,865,089 (GRCm39) probably null Het
Acot4 A C 12: 84,088,783 (GRCm39) E210D probably damaging Het
Adamts9 A C 6: 92,882,172 (GRCm39) S476A probably damaging Het
Ajm1 C CTCTA 2: 25,469,733 (GRCm39) probably null Het
Ak1 T A 2: 32,520,385 (GRCm39) M61K probably damaging Het
Ambp G T 4: 63,072,243 (GRCm39) S17* probably null Het
Anxa6 T A 11: 54,870,326 (GRCm39) M662L probably benign Het
Atp11b T C 3: 35,868,329 (GRCm39) I467T possibly damaging Het
B3gat1 G T 9: 26,662,998 (GRCm39) probably benign Het
Bccip T G 7: 133,319,488 (GRCm39) I193S probably damaging Het
Ccdc170 A G 10: 4,491,782 (GRCm39) E401G probably damaging Het
Cldn16 A G 16: 26,296,257 (GRCm39) T78A probably damaging Het
Cldn24 G T 8: 48,275,757 (GRCm39) A194S probably benign Het
Cltc A G 11: 86,595,054 (GRCm39) V1348A possibly damaging Het
Clvs1 T C 4: 9,282,014 (GRCm39) probably null Het
Csmd1 C T 8: 16,235,341 (GRCm39) D1161N probably damaging Het
Cuzd1 A G 7: 130,918,394 (GRCm39) V181A probably damaging Het
Dhx30 A G 9: 109,917,099 (GRCm39) I435T probably damaging Het
Dnmt3b C T 2: 153,528,204 (GRCm39) T822M probably damaging Het
Dock10 A T 1: 80,593,082 (GRCm39) F97I possibly damaging Het
Dock8 T C 19: 25,146,865 (GRCm39) probably null Het
Dvl2 T C 11: 69,900,099 (GRCm39) L631P probably damaging Het
Faf2 T A 13: 54,789,419 (GRCm39) probably null Het
Fat2 T A 11: 55,200,167 (GRCm39) H969L probably benign Het
Fsip2 T A 2: 82,815,544 (GRCm39) V3759E probably benign Het
Gm10985 A C 3: 53,752,674 (GRCm39) Y19S probably damaging Het
Gm973 T C 1: 59,669,328 (GRCm39) L793P probably damaging Het
H2-M1 A G 17: 36,981,327 (GRCm39) I236T probably damaging Het
Hif1a A T 12: 73,992,337 (GRCm39) R765* probably null Het
Htt A G 5: 34,940,111 (GRCm39) K77E probably damaging Het
Ift172 G T 5: 31,423,304 (GRCm39) Q826K probably benign Het
Inafm1 C T 7: 16,007,086 (GRCm39) A44T probably damaging Het
Kctd4 A G 14: 76,200,748 (GRCm39) T240A probably damaging Het
Klk1 A T 7: 43,878,883 (GRCm39) I124F probably damaging Het
Krbox5 A G 13: 67,981,986 (GRCm39) Q66R possibly damaging Het
Kremen1 T C 11: 5,145,051 (GRCm39) T442A probably benign Het
Mei4 T A 9: 81,907,574 (GRCm39) D202E probably benign Het
Mest T A 6: 30,746,286 (GRCm39) D284E probably damaging Het
Nsfl1c T A 2: 151,344,940 (GRCm39) Y95* probably null Het
Or10al5 T A 17: 38,063,315 (GRCm39) V190D possibly damaging Het
Or10am5 T C 7: 6,517,550 (GRCm39) M293V probably damaging Het
Or2ak4 T A 11: 58,648,783 (GRCm39) C97* probably null Het
Or4k38 T G 2: 111,165,659 (GRCm39) I255L probably benign Het
Pgm1 T A 4: 99,820,763 (GRCm39) I220N probably damaging Het
Pirt T A 11: 66,816,719 (GRCm39) V10E possibly damaging Het
Prl7d1 C A 13: 27,898,454 (GRCm39) M19I probably benign Het
Samhd1 T C 2: 156,949,417 (GRCm39) N490D probably benign Het
Scn2a C A 2: 65,519,013 (GRCm39) S413* probably null Het
Serpinb6e A T 13: 34,016,337 (GRCm39) probably null Het
Slitrk5 A G 14: 111,917,726 (GRCm39) D450G probably benign Het
Tchh A G 3: 93,350,718 (GRCm39) T53A probably damaging Het
Tmem44 A T 16: 30,362,039 (GRCm39) probably null Het
Tpm3-rs7 A G 14: 113,552,448 (GRCm39) E114G possibly damaging Het
Treml2 A G 17: 48,609,925 (GRCm39) Y119C probably damaging Het
Ubxn1 T A 19: 8,851,245 (GRCm39) probably null Het
Vmn2r84 A T 10: 130,222,147 (GRCm39) M691K probably benign Het
Vmn2r97 A T 17: 19,168,193 (GRCm39) I816F possibly damaging Het
Was GCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTC GCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCTC X: 7,952,450 (GRCm39) probably benign Het
Wfdc2 T C 2: 164,405,070 (GRCm39) probably null Het
Zscan4-ps3 T C 7: 11,346,986 (GRCm39) S341P probably damaging Het
Other mutations in Dip2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Dip2b APN 15 100,072,382 (GRCm39) missense probably damaging 1.00
IGL01716:Dip2b APN 15 100,107,517 (GRCm39) missense probably benign 0.00
IGL01893:Dip2b APN 15 100,069,101 (GRCm39) splice site probably benign
IGL01915:Dip2b APN 15 100,076,392 (GRCm39) missense probably damaging 1.00
IGL02125:Dip2b APN 15 100,084,131 (GRCm39) missense possibly damaging 0.60
IGL02200:Dip2b APN 15 100,049,083 (GRCm39) missense possibly damaging 0.93
IGL02506:Dip2b APN 15 100,055,162 (GRCm39) missense probably damaging 1.00
IGL02571:Dip2b APN 15 100,055,766 (GRCm39) missense possibly damaging 0.93
IGL02706:Dip2b APN 15 100,113,192 (GRCm39) missense probably damaging 0.98
IGL02983:Dip2b APN 15 100,029,903 (GRCm39) missense possibly damaging 0.81
IGL03120:Dip2b APN 15 100,101,008 (GRCm39) splice site probably benign
IGL03181:Dip2b APN 15 100,113,088 (GRCm39) missense probably damaging 0.98
IGL03229:Dip2b APN 15 100,105,719 (GRCm39) splice site probably benign
IGL03399:Dip2b APN 15 100,073,208 (GRCm39) missense possibly damaging 0.63
PIT4131001:Dip2b UTSW 15 100,100,233 (GRCm39) missense probably damaging 1.00
R0009:Dip2b UTSW 15 100,067,193 (GRCm39) missense probably damaging 1.00
R0058:Dip2b UTSW 15 100,113,121 (GRCm39) missense probably benign 0.03
R0058:Dip2b UTSW 15 100,113,121 (GRCm39) missense probably benign 0.03
R0092:Dip2b UTSW 15 100,100,146 (GRCm39) missense probably damaging 1.00
R0201:Dip2b UTSW 15 100,084,028 (GRCm39) missense probably damaging 0.98
R0359:Dip2b UTSW 15 100,109,874 (GRCm39) missense probably damaging 0.98
R0390:Dip2b UTSW 15 100,091,794 (GRCm39) missense probably damaging 0.99
R0564:Dip2b UTSW 15 100,060,600 (GRCm39) nonsense probably null
R0730:Dip2b UTSW 15 100,069,532 (GRCm39) missense probably damaging 1.00
R1144:Dip2b UTSW 15 100,052,131 (GRCm39) missense probably benign 0.11
R1200:Dip2b UTSW 15 100,107,626 (GRCm39) missense probably benign 0.00
R1506:Dip2b UTSW 15 100,080,994 (GRCm39) missense probably damaging 1.00
R1750:Dip2b UTSW 15 100,076,347 (GRCm39) missense probably benign
R1760:Dip2b UTSW 15 100,109,910 (GRCm39) missense probably damaging 1.00
R1773:Dip2b UTSW 15 100,091,842 (GRCm39) missense probably benign 0.00
R1812:Dip2b UTSW 15 100,096,819 (GRCm39) splice site probably null
R2264:Dip2b UTSW 15 100,101,097 (GRCm39) missense probably benign 0.05
R3105:Dip2b UTSW 15 100,040,018 (GRCm39) nonsense probably null
R4029:Dip2b UTSW 15 100,084,053 (GRCm39) missense probably damaging 1.00
R4030:Dip2b UTSW 15 100,084,053 (GRCm39) missense probably damaging 1.00
R4296:Dip2b UTSW 15 100,079,217 (GRCm39) missense probably benign
R4392:Dip2b UTSW 15 100,059,917 (GRCm39) missense probably damaging 1.00
R4480:Dip2b UTSW 15 100,084,182 (GRCm39) missense probably damaging 0.99
R4564:Dip2b UTSW 15 100,055,139 (GRCm39) nonsense probably null
R4605:Dip2b UTSW 15 100,107,517 (GRCm39) missense probably benign 0.00
R4606:Dip2b UTSW 15 100,113,210 (GRCm39) missense possibly damaging 0.91
R4634:Dip2b UTSW 15 100,058,372 (GRCm39) missense probably damaging 1.00
R4667:Dip2b UTSW 15 100,049,241 (GRCm39) missense probably benign 0.01
R4739:Dip2b UTSW 15 100,105,658 (GRCm39) missense probably damaging 0.98
R4826:Dip2b UTSW 15 100,067,162 (GRCm39) missense probably damaging 0.99
R4870:Dip2b UTSW 15 100,093,665 (GRCm39) splice site probably null
R4877:Dip2b UTSW 15 100,058,410 (GRCm39) missense possibly damaging 0.49
R4932:Dip2b UTSW 15 100,069,603 (GRCm39) missense probably damaging 1.00
R5009:Dip2b UTSW 15 100,093,665 (GRCm39) splice site probably null
R5169:Dip2b UTSW 15 100,102,994 (GRCm39) missense probably damaging 1.00
R5216:Dip2b UTSW 15 100,109,867 (GRCm39) missense probably damaging 1.00
R5218:Dip2b UTSW 15 100,052,177 (GRCm39) missense probably benign 0.00
R5274:Dip2b UTSW 15 100,109,985 (GRCm39) missense possibly damaging 0.54
R5370:Dip2b UTSW 15 100,109,867 (GRCm39) missense probably damaging 1.00
R5420:Dip2b UTSW 15 100,103,054 (GRCm39) intron probably benign
R5447:Dip2b UTSW 15 100,109,867 (GRCm39) missense probably damaging 1.00
R5670:Dip2b UTSW 15 100,087,985 (GRCm39) missense possibly damaging 0.80
R5768:Dip2b UTSW 15 100,055,826 (GRCm39) missense probably benign 0.32
R5908:Dip2b UTSW 15 100,049,065 (GRCm39) missense possibly damaging 0.93
R5957:Dip2b UTSW 15 100,107,575 (GRCm39) missense probably benign 0.03
R5987:Dip2b UTSW 15 100,087,960 (GRCm39) missense probably damaging 1.00
R6260:Dip2b UTSW 15 100,060,583 (GRCm39) missense probably benign 0.05
R6325:Dip2b UTSW 15 100,052,163 (GRCm39) missense probably benign 0.00
R6367:Dip2b UTSW 15 100,013,795 (GRCm39) missense possibly damaging 0.50
R6391:Dip2b UTSW 15 100,049,157 (GRCm39) missense probably damaging 1.00
R6422:Dip2b UTSW 15 100,096,892 (GRCm39) missense probably damaging 0.98
R6922:Dip2b UTSW 15 100,091,724 (GRCm39) missense probably benign 0.25
R7002:Dip2b UTSW 15 100,058,346 (GRCm39) missense probably benign 0.43
R7076:Dip2b UTSW 15 100,055,853 (GRCm39) splice site probably null
R7176:Dip2b UTSW 15 100,067,199 (GRCm39) missense probably damaging 1.00
R7255:Dip2b UTSW 15 100,107,508 (GRCm39) missense probably benign 0.00
R7463:Dip2b UTSW 15 100,052,038 (GRCm39) missense probably benign
R7513:Dip2b UTSW 15 100,105,629 (GRCm39) splice site probably null
R7876:Dip2b UTSW 15 100,088,922 (GRCm39) missense probably benign 0.02
R8368:Dip2b UTSW 15 100,052,124 (GRCm39) missense probably benign 0.00
R9289:Dip2b UTSW 15 100,071,152 (GRCm39) missense probably damaging 0.97
R9405:Dip2b UTSW 15 100,093,757 (GRCm39) missense probably benign 0.05
R9477:Dip2b UTSW 15 99,936,784 (GRCm39) missense probably damaging 1.00
R9485:Dip2b UTSW 15 100,052,924 (GRCm39) missense probably benign 0.05
R9533:Dip2b UTSW 15 100,073,178 (GRCm39) missense probably benign 0.06
R9581:Dip2b UTSW 15 100,079,255 (GRCm39) missense probably damaging 0.99
R9666:Dip2b UTSW 15 100,107,461 (GRCm39) missense probably damaging 1.00
X0064:Dip2b UTSW 15 100,013,731 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TATGCAGCCCACATGTCACC -3'
(R):5'- TGCATGAGTGTTCACAGCC -3'

Sequencing Primer
(F):5'- AGCCCACATGTCACCTGGTTG -3'
(R):5'- ATGAGTGTTCACAGCCCCTGC -3'
Posted On 2018-10-18