Incidental Mutation 'R6806:Prss58'
ID 537475
Institutional Source Beutler Lab
Gene Symbol Prss58
Ensembl Gene ENSMUSG00000051936
Gene Name protease, serine 58
Synonyms BC048599
MMRRC Submission
Accession Numbers
Essential gene? Probably non essential (E-score: 0.053) question?
Stock # R6806 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 40895270-40900387 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 40897732 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Lysine at position 58 (N58K)
Ref Sequence ENSEMBL: ENSMUSP00000069833 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063523]
AlphaFold Q8BW11
Predicted Effect probably damaging
Transcript: ENSMUST00000063523
AA Change: N58K

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000069833
Gene: ENSMUSG00000051936
AA Change: N58K

DomainStartEndE-ValueType
Tryp_SPc 22 234 4.49e-36 SMART
Meta Mutation Damage Score 0.1578 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 95% (39/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the trypsin family of serine proteases. This gene and several related trypsinogen genes are localized to the T cell receptor beta locus on chromosome 7. This gene was previously described as a trypsinogen-like pseudogene, but it is now thought to be a protein-coding gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,186,858 Q520R possibly damaging Het
9130019O22Rik T C 7: 127,386,594 probably benign Het
Agbl1 A G 7: 76,425,921 Y437C probably damaging Het
Apba2 T A 7: 64,695,459 D132E probably damaging Het
Atp13a4 A G 16: 29,469,280 S258P probably damaging Het
Bach2 T A 4: 32,575,301 M509K possibly damaging Het
Ccdc186 T A 19: 56,800,129 K549N probably damaging Het
Chrna3 C T 9: 55,015,810 R238H probably damaging Het
Cntnap5b G A 1: 99,940,649 C30Y probably damaging Het
Dnah11 T C 12: 117,987,676 probably null Het
Ebna1bp2 T C 4: 118,620,977 C16R probably benign Het
Gm884 T C 11: 103,621,124 E6G unknown Het
Grin2b A G 6: 135,774,828 Y579H possibly damaging Het
Ifi206 C T 1: 173,481,571 M286I probably benign Het
Itpr1 G A 6: 108,515,947 V2478I probably benign Het
Ltbp2 T C 12: 84,809,238 S744G possibly damaging Het
Magi3 T A 3: 104,046,969 N684I possibly damaging Het
Muc16 A G 9: 18,537,910 probably null Het
Nphp4 G T 4: 152,538,101 Q614H probably benign Het
Nprl3 A G 11: 32,267,509 I11T probably damaging Het
Olfr635 G T 7: 103,979,564 R124L possibly damaging Het
Pank2 T C 2: 131,262,707 probably benign Het
Ptk7 C T 17: 46,573,528 V759M probably damaging Het
Rassf7 A G 7: 141,216,809 T28A probably damaging Het
Rbm45 C T 2: 76,380,460 T445I probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Rsrc2 T G 5: 123,739,531 probably benign Het
Saxo2 A T 7: 82,635,032 I206N probably benign Het
Sh3d19 T A 3: 86,104,333 Y409N probably damaging Het
Spata31d1a A T 13: 59,703,218 N365K probably benign Het
Stkld1 C G 2: 26,943,910 N136K probably benign Het
Tenm4 A G 7: 96,811,959 D904G possibly damaging Het
Tmf1 G A 6: 97,161,447 R837* probably null Het
Tnn T C 1: 160,120,708 T812A possibly damaging Het
Trgj4 T C 13: 19,342,195 L15P probably damaging Het
Trp53bp1 T C 2: 121,228,666 I905V probably damaging Het
Ubr3 T C 2: 69,955,964 probably benign Het
Zfp446 T C 7: 12,979,116 L27P probably damaging Het
Zfp719 A G 7: 43,586,385 D57G possibly damaging Het
Zfp978 G A 4: 147,390,827 R277K probably benign Het
Other mutations in Prss58
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01096:Prss58 APN 6 40895465 missense probably damaging 1.00
IGL01108:Prss58 APN 6 40897344 missense probably damaging 1.00
IGL01645:Prss58 APN 6 40897310 missense probably damaging 0.98
R0032:Prss58 UTSW 6 40895699 missense probably benign 0.00
R0032:Prss58 UTSW 6 40895699 missense probably benign 0.00
R1622:Prss58 UTSW 6 40897314 missense possibly damaging 0.84
R2511:Prss58 UTSW 6 40897800 missense probably damaging 1.00
R4292:Prss58 UTSW 6 40897310 missense probably damaging 0.98
R5093:Prss58 UTSW 6 40897817 missense probably damaging 1.00
R5601:Prss58 UTSW 6 40897849 missense possibly damaging 0.92
R5992:Prss58 UTSW 6 40897769 missense probably damaging 1.00
R7105:Prss58 UTSW 6 40897766 missense probably damaging 1.00
R7136:Prss58 UTSW 6 40900053 critical splice donor site probably null
R7344:Prss58 UTSW 6 40895465 missense probably damaging 1.00
R7699:Prss58 UTSW 6 40895388 missense probably damaging 1.00
R7700:Prss58 UTSW 6 40895388 missense probably damaging 1.00
R7954:Prss58 UTSW 6 40895609 missense possibly damaging 0.92
R8305:Prss58 UTSW 6 40895660 missense probably benign 0.00
R8370:Prss58 UTSW 6 40895424 missense probably damaging 1.00
R9488:Prss58 UTSW 6 40897448 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- TTGAAGGTTCCTAGAATGATAGAGG -3'
(R):5'- GCTAGTGAAATATATTCCCTGCCC -3'

Sequencing Primer
(F):5'- CAAGTTGCTGGGTCTATG -3'
(R):5'- TGCTGTTATACTTTTGAACTTTTTGG -3'
Posted On 2018-10-18