Incidental Mutation 'R6806:Olfr635'
ID537487
Institutional Source Beutler Lab
Gene Symbol Olfr635
Ensembl Gene ENSMUSG00000094520
Gene Nameolfactory receptor 635
SynonymsGA_x6K02T2PBJ9-6713641-6714588, MOR5-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock #R6806 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location103971152-103987540 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 103979564 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Leucine at position 124 (R124L)
Ref Sequence ENSEMBL: ENSMUSP00000148103 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098185] [ENSMUST00000209473]
Predicted Effect possibly damaging
Transcript: ENSMUST00000098185
AA Change: R130L

PolyPhen 2 Score 0.724 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000095788
Gene: ENSMUSG00000094520
AA Change: R130L

DomainStartEndE-ValueType
Pfam:7tm_4 39 318 1.2e-119 PFAM
Pfam:7TM_GPCR_Srsx 43 182 1.3e-9 PFAM
Pfam:7tm_1 49 300 1.9e-18 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000209473
AA Change: R124L

PolyPhen 2 Score 0.724 (Sensitivity: 0.86; Specificity: 0.92)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 95% (39/41)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik A G 15: 8,186,858 Q520R possibly damaging Het
9130019O22Rik T C 7: 127,386,594 probably benign Het
Agbl1 A G 7: 76,425,921 Y437C probably damaging Het
Apba2 T A 7: 64,695,459 D132E probably damaging Het
Atp13a4 A G 16: 29,469,280 S258P probably damaging Het
Bach2 T A 4: 32,575,301 M509K possibly damaging Het
Ccdc186 T A 19: 56,800,129 K549N probably damaging Het
Chrna3 C T 9: 55,015,810 R238H probably damaging Het
Cntnap5b G A 1: 99,940,649 C30Y probably damaging Het
Dnah11 T C 12: 117,987,676 probably null Het
Ebna1bp2 T C 4: 118,620,977 C16R probably benign Het
Gm884 T C 11: 103,621,124 E6G unknown Het
Grin2b A G 6: 135,774,828 Y579H possibly damaging Het
Ifi206 C T 1: 173,481,571 M286I probably benign Het
Itpr1 G A 6: 108,515,947 V2478I probably benign Het
Ltbp2 T C 12: 84,809,238 S744G possibly damaging Het
Magi3 T A 3: 104,046,969 N684I possibly damaging Het
Muc16 A G 9: 18,537,910 probably null Het
Nphp4 G T 4: 152,538,101 Q614H probably benign Het
Nprl3 A G 11: 32,267,509 I11T probably damaging Het
Pank2 T C 2: 131,262,707 probably benign Het
Prss58 A T 6: 40,897,732 N58K probably damaging Het
Ptk7 C T 17: 46,573,528 V759M probably damaging Het
Rassf7 A G 7: 141,216,809 T28A probably damaging Het
Rbm45 C T 2: 76,380,460 T445I probably benign Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Rsrc2 T G 5: 123,739,531 probably benign Het
Saxo2 A T 7: 82,635,032 I206N probably benign Het
Sh3d19 T A 3: 86,104,333 Y409N probably damaging Het
Spata31d1a A T 13: 59,703,218 N365K probably benign Het
Stkld1 C G 2: 26,943,910 N136K probably benign Het
Tenm4 A G 7: 96,811,959 D904G possibly damaging Het
Tmf1 G A 6: 97,161,447 R837* probably null Het
Tnn T C 1: 160,120,708 T812A possibly damaging Het
Trgj4 T C 13: 19,342,195 L15P probably damaging Het
Trp53bp1 T C 2: 121,228,666 I905V probably damaging Het
Ubr3 T C 2: 69,955,964 probably benign Het
Zfp446 T C 7: 12,979,116 L27P probably damaging Het
Zfp719 A G 7: 43,586,385 D57G possibly damaging Het
Zfp978 G A 4: 147,390,827 R277K probably benign Het
Other mutations in Olfr635
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01064:Olfr635 APN 7 103979792 missense probably benign 0.09
IGL01330:Olfr635 APN 7 103980142 utr 3 prime probably benign
IGL01433:Olfr635 APN 7 103979332 missense probably damaging 1.00
FR4304:Olfr635 UTSW 7 103979903 frame shift probably null
FR4340:Olfr635 UTSW 7 103979903 frame shift probably null
FR4342:Olfr635 UTSW 7 103979903 frame shift probably null
R0271:Olfr635 UTSW 7 103979630 missense possibly damaging 0.83
R1909:Olfr635 UTSW 7 103979790 nonsense probably null
R2212:Olfr635 UTSW 7 103979402 missense probably damaging 0.98
R2484:Olfr635 UTSW 7 103979338 missense probably benign
R3412:Olfr635 UTSW 7 103979402 missense probably damaging 0.98
R4513:Olfr635 UTSW 7 103979441 missense probably benign 0.03
R4559:Olfr635 UTSW 7 103979560 missense probably damaging 1.00
R5032:Olfr635 UTSW 7 103979374 missense probably damaging 0.98
R5436:Olfr635 UTSW 7 103979266 missense probably benign
R5591:Olfr635 UTSW 7 103980113 missense probably benign 0.00
R5617:Olfr635 UTSW 7 103979714 missense possibly damaging 0.91
R5911:Olfr635 UTSW 7 103979708 missense probably benign
R6249:Olfr635 UTSW 7 103979611 missense possibly damaging 0.85
R6275:Olfr635 UTSW 7 103979974 missense probably damaging 1.00
R7589:Olfr635 UTSW 7 103979791 missense probably damaging 1.00
R8188:Olfr635 UTSW 7 103979536 missense probably damaging 1.00
R8337:Olfr635 UTSW 7 103979374 missense probably damaging 0.98
RF004:Olfr635 UTSW 7 103979903 frame shift probably null
RF005:Olfr635 UTSW 7 103979561 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTATCCGCACAGAGCCATC -3'
(R):5'- TATCCTGGTGGAGGCAGTAG -3'

Sequencing Primer
(F):5'- GCACAGAGCCATCTCTCC -3'
(R):5'- CTGGTGGAGGCAGTAGGAGTG -3'
Posted On2018-10-18