Incidental Mutation 'R6819:Dctn3'
ID537506
Institutional Source Beutler Lab
Gene Symbol Dctn3
Ensembl Gene ENSMUSG00000028447
Gene Namedynactin 3
Synonymsp24
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.964) question?
Stock #R6819 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location41714798-41723170 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 41715259 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 158 (T158S)
Ref Sequence ENSEMBL: ENSMUSP00000030158 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030158] [ENSMUST00000038434] [ENSMUST00000108041] [ENSMUST00000171641]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030158
AA Change: T158S

PolyPhen 2 Score 0.788 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000030158
Gene: ENSMUSG00000028447
AA Change: T158S

DomainStartEndE-ValueType
Pfam:Dynactin_p22 6 170 2.8e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000038434
SMART Domains Protein: ENSMUSP00000041477
Gene: ENSMUSG00000036114

DomainStartEndE-ValueType
Pfam:Alba 26 90 8.2e-16 PFAM
low complexity region 144 163 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108041
SMART Domains Protein: ENSMUSP00000103676
Gene: ENSMUSG00000073889

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IG 33 108 5.75e-4 SMART
FN3 112 204 2.18e-2 SMART
FN3 218 304 4.93e-1 SMART
low complexity region 354 365 N/A INTRINSIC
transmembrane domain 369 391 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171641
SMART Domains Protein: ENSMUSP00000130988
Gene: ENSMUSG00000028447

DomainStartEndE-ValueType
Pfam:Dynactin_p22 1 149 1.4e-63 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the smallest subunit of dynactin, a macromolecular complex consisting of 10 subunits ranging in size from 22 to 150 kD. Dynactin binds to both microtubules and cytoplasmic dynein. It is involved in a diverse array of cellular functions, including ER-to-Golgi transport, the centripetal movement of lysosomes and endosomes, spindle formation, cytokinesis, chromosome movement, nuclear positioning, and axonogenesis. This subunit, like most other dynactin subunits, exists only as a part of the dynactin complex. It is primarily an alpha-helical protein with very little coiled coil, and binds directly to the largest subunit (p150) of dynactin. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007K13Rik TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC 2: 28,466,110 probably benign Het
Abca17 C A 17: 24,287,793 V1196L probably benign Het
Adal T A 2: 121,148,313 I138N probably damaging Het
Arfgap1 T C 2: 180,971,685 probably null Het
Boc T C 16: 44,492,825 T559A probably damaging Het
Brip1 A G 11: 86,110,441 V723A possibly damaging Het
Cnot10 A C 9: 114,615,055 I424S probably benign Het
Cntnap4 T G 8: 112,803,226 S689A probably benign Het
Cuzd1 A T 7: 131,309,731 N506K possibly damaging Het
Dnaic2 A G 11: 114,745,091 I301V probably benign Het
Ebpl G T 14: 61,341,246 P180Q probably damaging Het
Epha5 T A 5: 84,106,790 Y489F probably damaging Het
Frmd8 T C 19: 5,865,180 N232S probably benign Het
Fuca1 T C 4: 135,932,956 Y262H probably damaging Het
Gfy T C 7: 45,177,551 I374V possibly damaging Het
Glg1 G A 8: 111,187,881 R424C probably damaging Het
Ica1 G T 6: 8,742,288 T115K probably damaging Het
Igf2bp2 T C 16: 22,060,836 E511G probably damaging Het
Jag2 C A 12: 112,910,541 R998L probably damaging Het
Kcnv1 G T 15: 45,109,117 L457I probably damaging Het
Mroh2a C A 1: 88,242,420 A685D possibly damaging Het
Ms4a8a T A 19: 11,076,379 H121L probably damaging Het
Muc5b T A 7: 141,858,863 S1849T unknown Het
Myo10 T C 15: 25,781,410 V997A possibly damaging Het
Olfr1513 A G 14: 52,349,699 Y116H probably damaging Het
Olfr969 T A 9: 39,795,609 I78N probably benign Het
Olfr980 T A 9: 40,006,548 M134L probably benign Het
Pate2 T A 9: 35,670,505 C32S probably damaging Het
Per1 G T 11: 69,101,458 Q179H probably damaging Het
Rbp2 T A 9: 98,509,561 V130E probably damaging Het
Rictor T A 15: 6,796,036 probably null Het
Rundc3a A T 11: 102,398,461 R153* probably null Het
Scrn3 C T 2: 73,319,482 A174V probably damaging Het
Serpina10 T A 12: 103,628,360 Q200L probably benign Het
Slc25a51 A T 4: 45,399,365 I275N possibly damaging Het
Spast C T 17: 74,367,286 H238Y possibly damaging Het
Speg A T 1: 75,391,812 I775F possibly damaging Het
Ssh1 G T 5: 113,946,790 T463K probably benign Het
Tm2d3 A G 7: 65,697,778 E151G probably damaging Het
Uggt2 A G 14: 119,026,435 I1061T probably damaging Het
Unc79 T G 12: 103,142,008 S1941A probably benign Het
Vcan T C 13: 89,705,125 D572G probably benign Het
Vmn2r16 T G 5: 109,340,546 S428R probably benign Het
Zeb1 A G 18: 5,591,917 D3G probably damaging Het
Zfp352 A G 4: 90,224,699 T359A probably benign Het
Zfp987 C A 4: 146,125,745 D582E probably benign Het
Zg16 G A 7: 127,050,520 P90S possibly damaging Het
Other mutations in Dctn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01462:Dctn3 APN 4 41719854 nonsense probably null
IGL03000:Dctn3 APN 4 41719912 missense possibly damaging 0.94
R1687:Dctn3 UTSW 4 41715407 missense probably damaging 1.00
R1835:Dctn3 UTSW 4 41720813 missense probably damaging 1.00
R2164:Dctn3 UTSW 4 41723065 nonsense probably null
R3427:Dctn3 UTSW 4 41719858 missense probably damaging 1.00
R4801:Dctn3 UTSW 4 41719904 nonsense probably null
R4802:Dctn3 UTSW 4 41719904 nonsense probably null
R5617:Dctn3 UTSW 4 41716407 missense possibly damaging 0.70
R5979:Dctn3 UTSW 4 41715393 splice site probably null
R6545:Dctn3 UTSW 4 41723084 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TTCAGAGATGAAGCTGTCTCTGC -3'
(R):5'- GCTATACGTTGGCCTACAGG -3'

Sequencing Primer
(F):5'- AAGCTGTCTCTGCCTTATAGAG -3'
(R):5'- GATCACTGAAGAGTCTAAGGCTCTC -3'
Posted On2018-10-18