Incidental Mutation 'R6819:Zfp352'
ID 537508
Institutional Source Beutler Lab
Gene Symbol Zfp352
Ensembl Gene ENSMUSG00000070902
Gene Name zinc finger protein 352
Synonyms 2czf48
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6819 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 90218820-90225702 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 90224699 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 359 (T359A)
Ref Sequence ENSEMBL: ENSMUSP00000102746 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080541] [ENSMUST00000107129]
AlphaFold A2AML7
Predicted Effect probably benign
Transcript: ENSMUST00000080541
AA Change: T359A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000079383
Gene: ENSMUSG00000070902
AA Change: T359A

DomainStartEndE-ValueType
ZnF_C2H2 459 483 3.34e-2 SMART
ZnF_C2H2 489 513 8.22e-2 SMART
ZnF_C2H2 519 542 1.76e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107129
AA Change: T359A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000102746
Gene: ENSMUSG00000070902
AA Change: T359A

DomainStartEndE-ValueType
ZnF_C2H2 459 483 3.34e-2 SMART
ZnF_C2H2 489 513 8.22e-2 SMART
ZnF_C2H2 519 542 1.76e-1 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007K13Rik TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC 2: 28,466,110 probably benign Het
Abca17 C A 17: 24,287,793 V1196L probably benign Het
Adal T A 2: 121,148,313 I138N probably damaging Het
Arfgap1 T C 2: 180,971,685 probably null Het
Boc T C 16: 44,492,825 T559A probably damaging Het
Brip1 A G 11: 86,110,441 V723A possibly damaging Het
Cnot10 A C 9: 114,615,055 I424S probably benign Het
Cntnap4 T G 8: 112,803,226 S689A probably benign Het
Cuzd1 A T 7: 131,309,731 N506K possibly damaging Het
Dctn3 T A 4: 41,715,259 T158S possibly damaging Het
Dnaic2 A G 11: 114,745,091 I301V probably benign Het
Ebpl G T 14: 61,341,246 P180Q probably damaging Het
Epha5 T A 5: 84,106,790 Y489F probably damaging Het
Frmd8 T C 19: 5,865,180 N232S probably benign Het
Fuca1 T C 4: 135,932,956 Y262H probably damaging Het
Gfy T C 7: 45,177,551 I374V possibly damaging Het
Glg1 G A 8: 111,187,881 R424C probably damaging Het
Ica1 G T 6: 8,742,288 T115K probably damaging Het
Igf2bp2 T C 16: 22,060,836 E511G probably damaging Het
Jag2 C A 12: 112,910,541 R998L probably damaging Het
Kcnv1 G T 15: 45,109,117 L457I probably damaging Het
Mroh2a C A 1: 88,242,420 A685D possibly damaging Het
Ms4a8a T A 19: 11,076,379 H121L probably damaging Het
Muc5b T A 7: 141,858,863 S1849T unknown Het
Myo10 T C 15: 25,781,410 V997A possibly damaging Het
Olfr1513 A G 14: 52,349,699 Y116H probably damaging Het
Olfr969 T A 9: 39,795,609 I78N probably benign Het
Olfr980 T A 9: 40,006,548 M134L probably benign Het
Pate2 T A 9: 35,670,505 C32S probably damaging Het
Per1 G T 11: 69,101,458 Q179H probably damaging Het
Rbp2 T A 9: 98,509,561 V130E probably damaging Het
Rictor T A 15: 6,796,036 probably null Het
Rundc3a A T 11: 102,398,461 R153* probably null Het
Scrn3 C T 2: 73,319,482 A174V probably damaging Het
Serpina10 T A 12: 103,628,360 Q200L probably benign Het
Slc25a51 A T 4: 45,399,365 I275N possibly damaging Het
Spast C T 17: 74,367,286 H238Y possibly damaging Het
Speg A T 1: 75,391,812 I775F possibly damaging Het
Ssh1 G T 5: 113,946,790 T463K probably benign Het
Tm2d3 A G 7: 65,697,778 E151G probably damaging Het
Uggt2 A G 14: 119,026,435 I1061T probably damaging Het
Unc79 T G 12: 103,142,008 S1941A probably benign Het
Vcan T C 13: 89,705,125 D572G probably benign Het
Vmn2r16 T G 5: 109,340,546 S428R probably benign Het
Zeb1 A G 18: 5,591,917 D3G probably damaging Het
Zfp987 C A 4: 146,125,745 D582E probably benign Het
Zg16 G A 7: 127,050,520 P90S possibly damaging Het
Other mutations in Zfp352
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01963:Zfp352 APN 4 90224154 missense possibly damaging 0.95
IGL02252:Zfp352 APN 4 90224130 missense probably benign 0.02
IGL03156:Zfp352 APN 4 90224087 missense possibly damaging 0.57
IGL03167:Zfp352 APN 4 90224702 missense probably damaging 0.99
IGL03190:Zfp352 APN 4 90223757 missense possibly damaging 0.94
IGL03335:Zfp352 APN 4 90224346 missense probably damaging 0.99
R0051:Zfp352 UTSW 4 90224285 missense probably damaging 0.99
R0403:Zfp352 UTSW 4 90225009 missense possibly damaging 0.60
R0550:Zfp352 UTSW 4 90224690 missense probably damaging 0.99
R0671:Zfp352 UTSW 4 90223919 missense probably benign
R1034:Zfp352 UTSW 4 90224156 missense possibly damaging 0.94
R1754:Zfp352 UTSW 4 90223809 missense probably benign 0.23
R2016:Zfp352 UTSW 4 90225171 missense probably benign 0.42
R2064:Zfp352 UTSW 4 90225120 missense probably benign 0.08
R2308:Zfp352 UTSW 4 90225243 missense probably benign 0.00
R3552:Zfp352 UTSW 4 90225102 missense probably benign 0.33
R3794:Zfp352 UTSW 4 90225149 missense probably damaging 1.00
R3795:Zfp352 UTSW 4 90225149 missense probably damaging 1.00
R4135:Zfp352 UTSW 4 90225024 missense probably damaging 0.96
R4356:Zfp352 UTSW 4 90223834 missense possibly damaging 0.91
R4409:Zfp352 UTSW 4 90225164 missense probably benign 0.00
R4590:Zfp352 UTSW 4 90224535 missense probably damaging 0.98
R4614:Zfp352 UTSW 4 90225081 missense probably benign 0.00
R4617:Zfp352 UTSW 4 90225081 missense probably benign 0.00
R4618:Zfp352 UTSW 4 90225081 missense probably benign 0.00
R4741:Zfp352 UTSW 4 90224940 missense possibly damaging 0.94
R4931:Zfp352 UTSW 4 90224304 missense probably damaging 0.98
R4959:Zfp352 UTSW 4 90224139 missense probably benign 0.01
R4973:Zfp352 UTSW 4 90224139 missense probably benign 0.01
R5167:Zfp352 UTSW 4 90224216 missense possibly damaging 0.94
R5260:Zfp352 UTSW 4 90224460 missense probably damaging 0.99
R5524:Zfp352 UTSW 4 90225104 missense possibly damaging 0.95
R5942:Zfp352 UTSW 4 90225070 missense probably damaging 0.98
R6802:Zfp352 UTSW 4 90225200 missense probably benign 0.33
R7072:Zfp352 UTSW 4 90224424 missense probably benign 0.00
R7099:Zfp352 UTSW 4 90224880 missense probably benign 0.00
R7569:Zfp352 UTSW 4 90223659 missense possibly damaging 0.77
R7645:Zfp352 UTSW 4 90224777 missense probably benign 0.13
R7705:Zfp352 UTSW 4 90225275 missense possibly damaging 0.94
R8424:Zfp352 UTSW 4 90224243 missense possibly damaging 0.87
R9180:Zfp352 UTSW 4 90224881 missense probably benign 0.38
R9378:Zfp352 UTSW 4 90224338 missense probably benign 0.13
R9509:Zfp352 UTSW 4 90224706 missense probably damaging 0.99
R9623:Zfp352 UTSW 4 90224891 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCAGGCTACAGATGTGACCAG -3'
(R):5'- CTGGACTAAACTGGAAGCCG -3'

Sequencing Primer
(F):5'- GCTACAGATGTGACCAGGATTTG -3'
(R):5'- ACTGGAAGCCGAAGAGTTTTTC -3'
Posted On 2018-10-18