Mutagenetix > Incidental Mutations

Incidental Mutation 'R6819:Cntnap4'

537520

Institutional Source

Beutler Lab

Gene Symbol

Cntnap4

Ensembl Gene

ENSMUSG00000031772

Gene Name

contactin associated protein-like 4

Synonyms

E130114F09Rik, Caspr4

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.094) question?

Stock #

R6819 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

112570043-112882717 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 112803226 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Alanine at position 689 (S689A)

Ref Sequence

ENSEMBL: ENSMUSP00000034225 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034225] [ENSMUST00000118171]

Predicted Effect

probably benign
Transcript: ENSMUST00000034225
AA Change: S689A

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)

SMART Domains

Protein: ENSMUSP00000034225
Gene: ENSMUSG00000031772
AA Change: S689A

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
FA58C	32	179	2.35e-19	SMART
LamG	206	343	5.14e-25	SMART
LamG	392	526	1.04e-25	SMART
EGF	554	588	1.4e0	SMART
Blast:FBG	591	775	1e-120	BLAST
LamG	815	942	1.01e-32	SMART
EGF	963	999	1.36e1	SMART
LamG	1040	1178	7.8e-16	SMART
transmembrane domain	1244	1266	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000118171
AA Change: S689A

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000112511
Gene: ENSMUSG00000031772
AA Change: S689A

Domain	Start	End	E-Value	Type
signal peptide	1	27	N/A	INTRINSIC
FA58C	32	179	2.35e-19	SMART
LamG	206	343	5.14e-25	SMART
LamG	392	526	1.04e-25	SMART
EGF	554	588	1.4e0	SMART
Blast:FBG	591	775	1e-120	BLAST
LamG	815	942	1.01e-32	SMART
EGF	963	999	1.36e1	SMART
LamG	1040	1178	2.06e-15	SMART
transmembrane domain	1244	1266	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the neurexin protein family. Members of this family function in the vertebrate nervous system as cell adhesion molecules and receptors. This protein contains epidermal growth factor repeats and laminin G domains. In addition, it includes an F5/8 type C domain, discoidin/neuropilin- and fibrinogen-like domains, and thrombospondin N-terminal-like domains. This protein may also play a role in proper neurotransmission in the dopaminergic and GABAergic systems and mutations in this gene may be associated with certain psychiatric illnesses. A polymorphism in an intron of this gene may be associated with longevity. [provided by RefSeq, Apr 2016]
PHENOTYPE: Homozygous knock-out mice show increased midbrain dopaminergic release in the nucleus accumbens, synaptic defects, impaired sensory-motor gating, and increased grooming behavior. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700007K13Rik	TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC	TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC	2: 28,466,110		probably benign	Het
Abca17	C	A	17: 24,287,793	V1196L	probably benign	Het
Adal	T	A	2: 121,148,313	I138N	probably damaging	Het
Arfgap1	T	C	2: 180,971,685		probably null	Het
Boc	T	C	16: 44,492,825	T559A	probably damaging	Het
Brip1	A	G	11: 86,110,441	V723A	possibly damaging	Het
Cnot10	A	C	9: 114,615,055	I424S	probably benign	Het
Cuzd1	A	T	7: 131,309,731	N506K	possibly damaging	Het
Dctn3	T	A	4: 41,715,259	T158S	possibly damaging	Het
Dnaic2	A	G	11: 114,745,091	I301V	probably benign	Het
Ebpl	G	T	14: 61,341,246	P180Q	probably damaging	Het
Epha5	T	A	5: 84,106,790	Y489F	probably damaging	Het
Frmd8	T	C	19: 5,865,180	N232S	probably benign	Het
Fuca1	T	C	4: 135,932,956	Y262H	probably damaging	Het
Gfy	T	C	7: 45,177,551	I374V	possibly damaging	Het
Glg1	G	A	8: 111,187,881	R424C	probably damaging	Het
Ica1	G	T	6: 8,742,288	T115K	probably damaging	Het
Igf2bp2	T	C	16: 22,060,836	E511G	probably damaging	Het
Jag2	C	A	12: 112,910,541	R998L	probably damaging	Het
Kcnv1	G	T	15: 45,109,117	L457I	probably damaging	Het
Mroh2a	C	A	1: 88,242,420	A685D	possibly damaging	Het
Ms4a8a	T	A	19: 11,076,379	H121L	probably damaging	Het
Muc5b	T	A	7: 141,858,863	S1849T	unknown	Het
Myo10	T	C	15: 25,781,410	V997A	possibly damaging	Het
Olfr1513	A	G	14: 52,349,699	Y116H	probably damaging	Het
Olfr969	T	A	9: 39,795,609	I78N	probably benign	Het
Olfr980	T	A	9: 40,006,548	M134L	probably benign	Het
Pate2	T	A	9: 35,670,505	C32S	probably damaging	Het
Per1	G	T	11: 69,101,458	Q179H	probably damaging	Het
Rbp2	T	A	9: 98,509,561	V130E	probably damaging	Het
Rictor	T	A	15: 6,796,036		probably null	Het
Rundc3a	A	T	11: 102,398,461	R153*	probably null	Het
Scrn3	C	T	2: 73,319,482	A174V	probably damaging	Het
Serpina10	T	A	12: 103,628,360	Q200L	probably benign	Het
Slc25a51	A	T	4: 45,399,365	I275N	possibly damaging	Het
Spast	C	T	17: 74,367,286	H238Y	possibly damaging	Het
Speg	A	T	1: 75,391,812	I775F	possibly damaging	Het
Ssh1	G	T	5: 113,946,790	T463K	probably benign	Het
Tm2d3	A	G	7: 65,697,778	E151G	probably damaging	Het
Uggt2	A	G	14: 119,026,435	I1061T	probably damaging	Het
Unc79	T	G	12: 103,142,008	S1941A	probably benign	Het
Vcan	T	C	13: 89,705,125	D572G	probably benign	Het
Vmn2r16	T	G	5: 109,340,546	S428R	probably benign	Het
Zeb1	A	G	18: 5,591,917	D3G	probably damaging	Het
Zfp352	A	G	4: 90,224,699	T359A	probably benign	Het
Zfp987	C	A	4: 146,125,745	D582E	probably benign	Het
Zg16	G	A	7: 127,050,520	P90S	possibly damaging	Het

Other mutations in Cntnap4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00847:Cntnap4	APN	8	112767619	splice site	probably benign
IGL01898:Cntnap4	APN	8	112856307	missense	possibly damaging	0.46
IGL01918:Cntnap4	APN	8	112752234	missense	possibly damaging	0.67
IGL02257:Cntnap4	APN	8	112616494	missense	probably damaging	1.00
IGL02302:Cntnap4	APN	8	112785903	splice site	probably benign
IGL02621:Cntnap4	APN	8	112810723	missense	probably damaging	1.00
IGL03008:Cntnap4	APN	8	112773590	missense	probably benign	0.06
IGL03327:Cntnap4	APN	8	112773576	missense	probably benign	0.00
IGL03346:Cntnap4	APN	8	112773576	missense	probably benign	0.00
R0025:Cntnap4	UTSW	8	112803164	missense	probably damaging	1.00
R0025:Cntnap4	UTSW	8	112803164	missense	probably damaging	1.00
R0058:Cntnap4	UTSW	8	112785784	missense	probably damaging	0.98
R0310:Cntnap4	UTSW	8	112842516	critical splice acceptor site	probably null
R0363:Cntnap4	UTSW	8	112856511	nonsense	probably null
R0497:Cntnap4	UTSW	8	112570151	missense	probably benign	0.00
R1495:Cntnap4	UTSW	8	112881763	missense	possibly damaging	0.81
R1579:Cntnap4	UTSW	8	112881830	missense	possibly damaging	0.89
R1704:Cntnap4	UTSW	8	112757523	missense	probably damaging	1.00
R1943:Cntnap4	UTSW	8	112815496	missense	probably benign	0.10
R2160:Cntnap4	UTSW	8	112757571	missense	probably damaging	1.00
R2226:Cntnap4	UTSW	8	112815488	missense	probably damaging	0.98
R3148:Cntnap4	UTSW	8	112757439	missense	probably damaging	1.00
R3916:Cntnap4	UTSW	8	112875533	missense	probably benign	0.02
R3917:Cntnap4	UTSW	8	112875533	missense	probably benign	0.02
R4097:Cntnap4	UTSW	8	112752307	missense	probably benign	0.03
R4348:Cntnap4	UTSW	8	112753922	missense	probably damaging	1.00
R4469:Cntnap4	UTSW	8	112665266	missense	probably damaging	1.00
R4530:Cntnap4	UTSW	8	112858210	missense	probably benign	0.32
R4531:Cntnap4	UTSW	8	112810608	missense	possibly damaging	0.90
R4586:Cntnap4	UTSW	8	112810710	missense	probably benign
R4611:Cntnap4	UTSW	8	112773739	critical splice donor site	probably null
R4675:Cntnap4	UTSW	8	112785836	missense	probably damaging	1.00
R4801:Cntnap4	UTSW	8	112773590	missense	possibly damaging	0.94
R4802:Cntnap4	UTSW	8	112773590	missense	possibly damaging	0.94
R5273:Cntnap4	UTSW	8	112733438	missense	probably damaging	1.00
R6114:Cntnap4	UTSW	8	112841753	missense	probably damaging	1.00
R6194:Cntnap4	UTSW	8	112875429	missense	probably damaging	1.00
R6222:Cntnap4	UTSW	8	112842721	missense	probably damaging	1.00
R6262:Cntnap4	UTSW	8	112803211	missense	probably damaging	0.99
R6276:Cntnap4	UTSW	8	112752289	missense	possibly damaging	0.94
R6483:Cntnap4	UTSW	8	112757473	missense	possibly damaging	0.82
R7031:Cntnap4	UTSW	8	112858242	missense	probably benign	0.01
R7107:Cntnap4	UTSW	8	112815488	missense	probably damaging	0.98
R7146:Cntnap4	UTSW	8	112810636	missense	probably damaging	1.00
R7192:Cntnap4	UTSW	8	112881800	missense	probably benign	0.05
R7232:Cntnap4	UTSW	8	112665099	splice site	probably null
R7348:Cntnap4	UTSW	8	112665277	missense	probably damaging	1.00
R7482:Cntnap4	UTSW	8	112733562	critical splice donor site	probably null
R7832:Cntnap4	UTSW	8	112757481	missense	probably benign
R7895:Cntnap4	UTSW	8	112752197	missense	probably damaging	0.99
R8014:Cntnap4	UTSW	8	112753945	missense	probably damaging	0.99
R8185:Cntnap4	UTSW	8	112665265	missense	probably damaging	1.00
R8197:Cntnap4	UTSW	8	112570225	missense	probably benign	0.00
R8287:Cntnap4	UTSW	8	112859143	missense	probably damaging	1.00
R8299:Cntnap4	UTSW	8	112773692	missense	probably damaging	1.00
R8498:Cntnap4	UTSW	8	112875579	missense	possibly damaging	0.52
X0025:Cntnap4	UTSW	8	112859143	missense	probably damaging	1.00
X0063:Cntnap4	UTSW	8	112875579	missense	probably benign	0.05
Z1088:Cntnap4	UTSW	8	112815520	missense	probably damaging	1.00
Z1176:Cntnap4	UTSW	8	112858189	missense	possibly damaging	0.70

Predicted Primers

PCR Primer
(F):5'- TTTGCAGACTAGTGACGGTCTC -3'
(R):5'- AGCATCCACGAGACTTCCAG -3'

Sequencing Primer
(F):5'- TTTCTGCATACAAGAAACGGCATGG -3'
(R):5'- CCAGACTGTGACAAGTTTGC -3'

Posted On

2018-10-18