Mutagenetix > Incidental Mutation

Incidental Mutation 'R6819:Jag2'

537532

Institutional Source

Beutler Lab

Gene Symbol

Jag2

Ensembl Gene

ENSMUSG00000002799

Gene Name

jagged 2

Synonyms

Serh, D12Ggc2e

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6819 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

112907819-112929776 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 112910541 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Leucine at position 998 (R998L)

Ref Sequence

ENSEMBL: ENSMUSP00000075224 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075827]

AlphaFold

Q9QYE5

Predicted Effect

probably damaging
Transcript: ENSMUST00000075827
AA Change: R998L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000075224
Gene: ENSMUSG00000002799
AA Change: R998L

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
Pfam:MNNL	26	105	4.2e-31	PFAM
low complexity region	108	123	N/A	INTRINSIC
DSL	178	240	1.48e-36	SMART
EGF_like	244	274	7.23e1	SMART
EGF	275	305	4.56e0	SMART
EGF_CA	307	345	8.5e-9	SMART
EGF	350	383	4e-5	SMART
EGF_CA	385	421	5.39e-11	SMART
EGF_CA	423	459	3.51e-10	SMART
EGF_CA	461	496	1.01e-10	SMART
EGF_CA	498	534	1.17e-6	SMART
EGF_CA	536	572	6.35e-8	SMART
EGF	588	634	7.53e-1	SMART
EGF_CA	636	672	2.89e-11	SMART
EGF	677	710	3.68e-4	SMART
EGF	715	748	1.32e-5	SMART
EGF	754	787	1.34e-6	SMART
EGF_CA	789	825	2.58e-8	SMART
EGF_CA	827	863	7.23e-12	SMART
VWC	872	949	1.3e-1	SMART
low complexity region	1002	1035	N/A	INTRINSIC
transmembrane domain	1085	1107	N/A	INTRINSIC
low complexity region	1109	1119	N/A	INTRINSIC
low complexity region	1170	1199	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000223140

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Notch signaling pathway is an intercellular signaling mechanism that is essential for proper embryonic development. Members of the Notch gene family encode transmembrane receptors that are critical for various cell fate decisions. The protein encoded by this gene is one of several ligands that activate Notch and related receptors. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation die perinatally with craniofacial defects, fused digits, and increased numbers of sensory hair cells in the cochlea. Homozygotes for a spontaneous mutation exhibit fused digits and sometimes tail kinks. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700007K13Rik	TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC	TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC	2: 28,466,110		probably benign	Het
Abca17	C	A	17: 24,287,793	V1196L	probably benign	Het
Adal	T	A	2: 121,148,313	I138N	probably damaging	Het
Arfgap1	T	C	2: 180,971,685		probably null	Het
Boc	T	C	16: 44,492,825	T559A	probably damaging	Het
Brip1	A	G	11: 86,110,441	V723A	possibly damaging	Het
Cnot10	A	C	9: 114,615,055	I424S	probably benign	Het
Cntnap4	T	G	8: 112,803,226	S689A	probably benign	Het
Cuzd1	A	T	7: 131,309,731	N506K	possibly damaging	Het
Dctn3	T	A	4: 41,715,259	T158S	possibly damaging	Het
Dnaic2	A	G	11: 114,745,091	I301V	probably benign	Het
Ebpl	G	T	14: 61,341,246	P180Q	probably damaging	Het
Epha5	T	A	5: 84,106,790	Y489F	probably damaging	Het
Frmd8	T	C	19: 5,865,180	N232S	probably benign	Het
Fuca1	T	C	4: 135,932,956	Y262H	probably damaging	Het
Gfy	T	C	7: 45,177,551	I374V	possibly damaging	Het
Glg1	G	A	8: 111,187,881	R424C	probably damaging	Het
Ica1	G	T	6: 8,742,288	T115K	probably damaging	Het
Igf2bp2	T	C	16: 22,060,836	E511G	probably damaging	Het
Kcnv1	G	T	15: 45,109,117	L457I	probably damaging	Het
Mroh2a	C	A	1: 88,242,420	A685D	possibly damaging	Het
Ms4a8a	T	A	19: 11,076,379	H121L	probably damaging	Het
Muc5b	T	A	7: 141,858,863	S1849T	unknown	Het
Myo10	T	C	15: 25,781,410	V997A	possibly damaging	Het
Olfr1513	A	G	14: 52,349,699	Y116H	probably damaging	Het
Olfr969	T	A	9: 39,795,609	I78N	probably benign	Het
Olfr980	T	A	9: 40,006,548	M134L	probably benign	Het
Pate2	T	A	9: 35,670,505	C32S	probably damaging	Het
Per1	G	T	11: 69,101,458	Q179H	probably damaging	Het
Rbp2	T	A	9: 98,509,561	V130E	probably damaging	Het
Rictor	T	A	15: 6,796,036		probably null	Het
Rundc3a	A	T	11: 102,398,461	R153*	probably null	Het
Scrn3	C	T	2: 73,319,482	A174V	probably damaging	Het
Serpina10	T	A	12: 103,628,360	Q200L	probably benign	Het
Slc25a51	A	T	4: 45,399,365	I275N	possibly damaging	Het
Spast	C	T	17: 74,367,286	H238Y	possibly damaging	Het
Speg	A	T	1: 75,391,812	I775F	possibly damaging	Het
Ssh1	G	T	5: 113,946,790	T463K	probably benign	Het
Tm2d3	A	G	7: 65,697,778	E151G	probably damaging	Het
Uggt2	A	G	14: 119,026,435	I1061T	probably damaging	Het
Unc79	T	G	12: 103,142,008	S1941A	probably benign	Het
Vcan	T	C	13: 89,705,125	D572G	probably benign	Het
Vmn2r16	T	G	5: 109,340,546	S428R	probably benign	Het
Zeb1	A	G	18: 5,591,917	D3G	probably damaging	Het
Zfp352	A	G	4: 90,224,699	T359A	probably benign	Het
Zfp987	C	A	4: 146,125,745	D582E	probably benign	Het
Zg16	G	A	7: 127,050,520	P90S	possibly damaging	Het

Other mutations in Jag2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00157:Jag2	APN	12	112912718	missense	probably benign	0.20
IGL00954:Jag2	APN	12	112920406	missense	possibly damaging	0.50
IGL01532:Jag2	APN	12	112914363	missense	probably damaging	0.98
IGL01646:Jag2	APN	12	112916349	missense	possibly damaging	0.65
IGL02243:Jag2	APN	12	112916345	missense	possibly damaging	0.94
IGL02447:Jag2	APN	12	112912612	missense	probably damaging	1.00
IGL02458:Jag2	APN	12	112915993	missense	probably damaging	0.98
IGL02516:Jag2	APN	12	112910566	missense	probably damaging	1.00
IGL02574:Jag2	APN	12	112915511	missense	probably benign	0.32
IGL02629:Jag2	APN	12	112914514	splice site	probably benign
IGL02873:Jag2	APN	12	112910502	missense	probably benign	0.00
IGL03087:Jag2	APN	12	112913948	missense	possibly damaging	0.60
Jaguarundi	UTSW	12	112915469	critical splice donor site	probably null
R0068:Jag2	UTSW	12	112915193	splice site	probably benign
R0310:Jag2	UTSW	12	112913377	unclassified	probably benign
R0963:Jag2	UTSW	12	112915314	missense	probably damaging	1.00
R1188:Jag2	UTSW	12	112920121	nonsense	probably null
R1256:Jag2	UTSW	12	112914419	missense	possibly damaging	0.50
R1298:Jag2	UTSW	12	112916319	unclassified	probably benign
R1317:Jag2	UTSW	12	112914501	missense	probably benign
R2079:Jag2	UTSW	12	112920377	missense	probably damaging	1.00
R2345:Jag2	UTSW	12	112909064	missense	probably damaging	1.00
R4654:Jag2	UTSW	12	112913646	missense	probably benign	0.13
R4782:Jag2	UTSW	12	112914249	missense	probably benign
R4798:Jag2	UTSW	12	112916632	missense	probably benign	0.01
R5242:Jag2	UTSW	12	112916866	missense	probably damaging	0.97
R5350:Jag2	UTSW	12	112908922	missense	possibly damaging	0.77
R5364:Jag2	UTSW	12	112910534	missense	probably damaging	1.00
R6129:Jag2	UTSW	12	112920349	nonsense	probably null
R6362:Jag2	UTSW	12	112920122	missense	probably damaging	0.97
R6376:Jag2	UTSW	12	112909329	missense	probably benign	0.00
R6844:Jag2	UTSW	12	112916714	missense	probably damaging	1.00
R6968:Jag2	UTSW	12	112914258	missense	probably benign	0.10
R7514:Jag2	UTSW	12	112929052	missense	probably benign	0.19
R7663:Jag2	UTSW	12	112913666	missense	probably damaging	1.00
R7730:Jag2	UTSW	12	112922041	missense	probably damaging	1.00
R7754:Jag2	UTSW	12	112915469	critical splice donor site	probably null
R7828:Jag2	UTSW	12	112913180	missense	probably benign	0.19
R7874:Jag2	UTSW	12	112915946	missense	probably damaging	0.99
R8075:Jag2	UTSW	12	112915274	missense	probably benign	0.05
R8845:Jag2	UTSW	12	112920094	missense	probably damaging	1.00
R8876:Jag2	UTSW	12	112909637	missense	probably benign	0.00
R9117:Jag2	UTSW	12	112913659	nonsense	probably null
R9400:Jag2	UTSW	12	112911988	nonsense	probably null
R9673:Jag2	UTSW	12	112911796	nonsense	probably null
R9688:Jag2	UTSW	12	112908944	missense	probably benign	0.30

Predicted Primers

PCR Primer
(F):5'- CATTCCACCATGTAAGTGCCTC -3'
(R):5'- AACAGGGGCTCGAACTCAAC -3'

Sequencing Primer
(F):5'- ATGTAAGTGCCTCCCCGTC -3'
(R):5'- TCGAACTCAACGGTGGC -3'

Posted On

2018-10-18