Incidental Mutation 'R6819:Abca17'
ID 537542
Institutional Source Beutler Lab
Gene Symbol Abca17
Ensembl Gene ENSMUSG00000035435
Gene Name ATP-binding cassette, sub-family A (ABC1), member 17
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6819 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 24264259-24351029 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 24287793 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Leucine at position 1196 (V1196L)
Ref Sequence ENSEMBL: ENSMUSP00000112538 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039324] [ENSMUST00000121226]
AlphaFold E9PX95
Predicted Effect probably benign
Transcript: ENSMUST00000039324
AA Change: V1196L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000046218
Gene: ENSMUSG00000035435
AA Change: V1196L

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
transmembrane domain 22 44 N/A INTRINSIC
Pfam:ABC2_membrane_3 252 464 9.5e-17 PFAM
AAA 547 729 5.71e-12 SMART
low complexity region 846 857 N/A INTRINSIC
Pfam:ABC2_membrane_3 905 1307 6.7e-35 PFAM
low complexity region 1337 1351 N/A INTRINSIC
AAA 1393 1577 1.15e-1 SMART
low complexity region 1697 1730 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121226
AA Change: V1196L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000112538
Gene: ENSMUSG00000035435
AA Change: V1196L

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
Pfam:ABC2_membrane_3 21 464 1.2e-15 PFAM
AAA 547 729 5.71e-12 SMART
low complexity region 846 857 N/A INTRINSIC
Pfam:ABC2_membrane_3 905 1307 1.1e-32 PFAM
low complexity region 1337 1351 N/A INTRINSIC
AAA 1393 1577 1.15e-1 SMART
low complexity region 1697 1730 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007K13Rik TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC 2: 28,466,110 probably benign Het
Adal T A 2: 121,148,313 I138N probably damaging Het
Arfgap1 T C 2: 180,971,685 probably null Het
Boc T C 16: 44,492,825 T559A probably damaging Het
Brip1 A G 11: 86,110,441 V723A possibly damaging Het
Cnot10 A C 9: 114,615,055 I424S probably benign Het
Cntnap4 T G 8: 112,803,226 S689A probably benign Het
Cuzd1 A T 7: 131,309,731 N506K possibly damaging Het
Dctn3 T A 4: 41,715,259 T158S possibly damaging Het
Dnaic2 A G 11: 114,745,091 I301V probably benign Het
Ebpl G T 14: 61,341,246 P180Q probably damaging Het
Epha5 T A 5: 84,106,790 Y489F probably damaging Het
Frmd8 T C 19: 5,865,180 N232S probably benign Het
Fuca1 T C 4: 135,932,956 Y262H probably damaging Het
Gfy T C 7: 45,177,551 I374V possibly damaging Het
Glg1 G A 8: 111,187,881 R424C probably damaging Het
Ica1 G T 6: 8,742,288 T115K probably damaging Het
Igf2bp2 T C 16: 22,060,836 E511G probably damaging Het
Jag2 C A 12: 112,910,541 R998L probably damaging Het
Kcnv1 G T 15: 45,109,117 L457I probably damaging Het
Mroh2a C A 1: 88,242,420 A685D possibly damaging Het
Ms4a8a T A 19: 11,076,379 H121L probably damaging Het
Muc5b T A 7: 141,858,863 S1849T unknown Het
Myo10 T C 15: 25,781,410 V997A possibly damaging Het
Olfr1513 A G 14: 52,349,699 Y116H probably damaging Het
Olfr969 T A 9: 39,795,609 I78N probably benign Het
Olfr980 T A 9: 40,006,548 M134L probably benign Het
Pate2 T A 9: 35,670,505 C32S probably damaging Het
Per1 G T 11: 69,101,458 Q179H probably damaging Het
Rbp2 T A 9: 98,509,561 V130E probably damaging Het
Rictor T A 15: 6,796,036 probably null Het
Rundc3a A T 11: 102,398,461 R153* probably null Het
Scrn3 C T 2: 73,319,482 A174V probably damaging Het
Serpina10 T A 12: 103,628,360 Q200L probably benign Het
Slc25a51 A T 4: 45,399,365 I275N possibly damaging Het
Spast C T 17: 74,367,286 H238Y possibly damaging Het
Speg A T 1: 75,391,812 I775F possibly damaging Het
Ssh1 G T 5: 113,946,790 T463K probably benign Het
Tm2d3 A G 7: 65,697,778 E151G probably damaging Het
Uggt2 A G 14: 119,026,435 I1061T probably damaging Het
Unc79 T G 12: 103,142,008 S1941A probably benign Het
Vcan T C 13: 89,705,125 D572G probably benign Het
Vmn2r16 T G 5: 109,340,546 S428R probably benign Het
Zeb1 A G 18: 5,591,917 D3G probably damaging Het
Zfp352 A G 4: 90,224,699 T359A probably benign Het
Zfp987 C A 4: 146,125,745 D582E probably benign Het
Zg16 G A 7: 127,050,520 P90S possibly damaging Het
Other mutations in Abca17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Abca17 APN 17 24295191 missense probably benign 0.14
IGL00585:Abca17 APN 17 24300320 missense probably damaging 0.99
IGL00941:Abca17 APN 17 24317130 missense probably damaging 1.00
IGL01987:Abca17 APN 17 24346228 missense probably benign 0.00
IGL01988:Abca17 APN 17 24334255 missense probably damaging 0.99
IGL02223:Abca17 APN 17 24287935 nonsense probably null
IGL02368:Abca17 APN 17 24287793 missense probably benign 0.01
IGL02405:Abca17 APN 17 24279062 missense possibly damaging 0.80
IGL02431:Abca17 APN 17 24298984 missense probably benign 0.05
IGL02607:Abca17 APN 17 24327705 nonsense probably null
IGL02706:Abca17 APN 17 24298992 missense probably benign 0.00
IGL02729:Abca17 APN 17 24280481 missense probably benign 0.06
IGL02818:Abca17 APN 17 24300352 missense probably benign 0.02
IGL02891:Abca17 APN 17 24281366 missense probably damaging 0.99
IGL03236:Abca17 APN 17 24326476 splice site probably benign
IGL03299:Abca17 APN 17 24265591 missense probably damaging 1.00
basin UTSW 17 24318185 missense probably benign 0.01
Bowl UTSW 17 24317238 missense probably benign 0.09
R0018:Abca17 UTSW 17 24313188 splice site probably null
R0467:Abca17 UTSW 17 24313177 splice site probably benign
R0671:Abca17 UTSW 17 24281249 missense probably benign 0.00
R1175:Abca17 UTSW 17 24289351 missense possibly damaging 0.91
R1397:Abca17 UTSW 17 24285759 missense probably benign 0.18
R1398:Abca17 UTSW 17 24328537 missense probably damaging 0.96
R1678:Abca17 UTSW 17 24335620 missense probably benign 0.05
R1696:Abca17 UTSW 17 24267658 missense possibly damaging 0.90
R1781:Abca17 UTSW 17 24267557 missense possibly damaging 0.95
R1845:Abca17 UTSW 17 24267716 missense probably damaging 1.00
R1970:Abca17 UTSW 17 24307575 missense probably benign 0.00
R1997:Abca17 UTSW 17 24285726 missense probably benign 0.02
R2141:Abca17 UTSW 17 24334266 missense probably benign 0.00
R2199:Abca17 UTSW 17 24335624 missense probably benign 0.19
R2394:Abca17 UTSW 17 24281216 splice site probably null
R2442:Abca17 UTSW 17 24328632 missense probably benign 0.02
R2509:Abca17 UTSW 17 24289613 splice site probably benign
R2848:Abca17 UTSW 17 24289507 missense probably damaging 0.96
R2849:Abca17 UTSW 17 24289507 missense probably damaging 0.96
R2859:Abca17 UTSW 17 24281314 missense possibly damaging 0.46
R2879:Abca17 UTSW 17 24289507 missense probably damaging 0.96
R2935:Abca17 UTSW 17 24289507 missense probably damaging 0.96
R3153:Abca17 UTSW 17 24328746 missense probably damaging 1.00
R3154:Abca17 UTSW 17 24328746 missense probably damaging 1.00
R3434:Abca17 UTSW 17 24289537 missense probably damaging 1.00
R3695:Abca17 UTSW 17 24289507 missense probably damaging 0.96
R3905:Abca17 UTSW 17 24296283 missense probably benign 0.13
R4282:Abca17 UTSW 17 24299060 missense possibly damaging 0.49
R4334:Abca17 UTSW 17 24318268 missense probably damaging 1.00
R4350:Abca17 UTSW 17 24279046 critical splice donor site probably null
R4548:Abca17 UTSW 17 24334271 missense possibly damaging 0.82
R4626:Abca17 UTSW 17 24321084 missense probably damaging 1.00
R4722:Abca17 UTSW 17 24265429 missense probably damaging 1.00
R4745:Abca17 UTSW 17 24307453 missense probably damaging 1.00
R4818:Abca17 UTSW 17 24317161 missense probably damaging 0.98
R5279:Abca17 UTSW 17 24289414 missense probably damaging 1.00
R5310:Abca17 UTSW 17 24281230 missense probably benign 0.00
R5320:Abca17 UTSW 17 24307567 missense probably damaging 1.00
R5435:Abca17 UTSW 17 24267614 missense possibly damaging 0.90
R5622:Abca17 UTSW 17 24327668 missense probably benign 0.14
R5776:Abca17 UTSW 17 24295158 missense probably benign 0.09
R5928:Abca17 UTSW 17 24318185 missense probably benign 0.01
R6013:Abca17 UTSW 17 24287846 missense possibly damaging 0.79
R6035:Abca17 UTSW 17 24281245 missense possibly damaging 0.79
R6035:Abca17 UTSW 17 24281245 missense possibly damaging 0.79
R6052:Abca17 UTSW 17 24318191 missense probably benign 0.00
R6063:Abca17 UTSW 17 24264344 missense unknown
R6404:Abca17 UTSW 17 24265918 missense probably benign 0.13
R6746:Abca17 UTSW 17 24346221 nonsense probably null
R6828:Abca17 UTSW 17 24326415 missense possibly damaging 0.91
R7043:Abca17 UTSW 17 24265500 missense probably damaging 1.00
R7065:Abca17 UTSW 17 24327751 missense probably damaging 1.00
R7123:Abca17 UTSW 17 24265975 missense probably damaging 1.00
R7157:Abca17 UTSW 17 24335590 missense possibly damaging 0.46
R7188:Abca17 UTSW 17 24335626 missense possibly damaging 0.89
R7294:Abca17 UTSW 17 24321009 missense not run
R7352:Abca17 UTSW 17 24289054 nonsense probably null
R7355:Abca17 UTSW 17 24267647 missense probably benign 0.00
R7358:Abca17 UTSW 17 24291555 missense probably benign 0.00
R7411:Abca17 UTSW 17 24328569 missense possibly damaging 0.52
R7915:Abca17 UTSW 17 24265533 missense probably damaging 1.00
R8039:Abca17 UTSW 17 24328725 missense probably damaging 1.00
R8095:Abca17 UTSW 17 24317222 missense possibly damaging 0.77
R8308:Abca17 UTSW 17 24267683 missense probably damaging 1.00
R8517:Abca17 UTSW 17 24317233 missense probably benign 0.00
R8811:Abca17 UTSW 17 24317238 missense probably benign 0.09
R8819:Abca17 UTSW 17 24328602 missense probably damaging 1.00
R8820:Abca17 UTSW 17 24328602 missense probably damaging 1.00
R8953:Abca17 UTSW 17 24299041 missense probably benign
R9095:Abca17 UTSW 17 24281396 missense probably damaging 0.97
R9313:Abca17 UTSW 17 24346233 missense probably benign 0.00
R9314:Abca17 UTSW 17 24328619 missense possibly damaging 0.91
R9347:Abca17 UTSW 17 24264505 missense probably benign
R9351:Abca17 UTSW 17 24291777 missense probably benign 0.00
R9387:Abca17 UTSW 17 24334281 missense probably benign 0.02
R9388:Abca17 UTSW 17 24264299 missense unknown
RF024:Abca17 UTSW 17 24287732 frame shift probably null
RF029:Abca17 UTSW 17 24287727 critical splice donor site probably benign
RF032:Abca17 UTSW 17 24287727 frame shift probably null
RF036:Abca17 UTSW 17 24287727 critical splice donor site probably benign
X0017:Abca17 UTSW 17 24317163 missense probably benign 0.26
X0065:Abca17 UTSW 17 24334284 missense probably damaging 1.00
Z1088:Abca17 UTSW 17 24279079 missense probably damaging 0.96
Z1088:Abca17 UTSW 17 24279107 missense probably benign 0.03
Z1088:Abca17 UTSW 17 24346219 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGAGTTGTTTGTCCACCCTG -3'
(R):5'- GGATGAACCCTTACGGACTC -3'

Sequencing Primer
(F):5'- TGTGTTCGGCCCACAGC -3'
(R):5'- GATGAACCCTTACGGACTCTTCCC -3'
Posted On 2018-10-18