Incidental Mutation 'R6819:Abca17'
ID 537542
Institutional Source Beutler Lab
Gene Symbol Abca17
Ensembl Gene ENSMUSG00000035435
Gene Name ATP-binding cassette, sub-family A member 17
Synonyms
MMRRC Submission 044931-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6819 (G1)
Quality Score 225.009
Status Not validated
Chromosome 17
Chromosomal Location 24483233-24570042 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 24506767 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Leucine at position 1196 (V1196L)
Ref Sequence ENSEMBL: ENSMUSP00000112538 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039324] [ENSMUST00000121226]
AlphaFold E9PX95
Predicted Effect probably benign
Transcript: ENSMUST00000039324
AA Change: V1196L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000046218
Gene: ENSMUSG00000035435
AA Change: V1196L

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
transmembrane domain 22 44 N/A INTRINSIC
Pfam:ABC2_membrane_3 252 464 9.5e-17 PFAM
AAA 547 729 5.71e-12 SMART
low complexity region 846 857 N/A INTRINSIC
Pfam:ABC2_membrane_3 905 1307 6.7e-35 PFAM
low complexity region 1337 1351 N/A INTRINSIC
AAA 1393 1577 1.15e-1 SMART
low complexity region 1697 1730 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121226
AA Change: V1196L

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000112538
Gene: ENSMUSG00000035435
AA Change: V1196L

DomainStartEndE-ValueType
low complexity region 4 18 N/A INTRINSIC
Pfam:ABC2_membrane_3 21 464 1.2e-15 PFAM
AAA 547 729 5.71e-12 SMART
low complexity region 846 857 N/A INTRINSIC
Pfam:ABC2_membrane_3 905 1307 1.1e-32 PFAM
low complexity region 1337 1351 N/A INTRINSIC
AAA 1393 1577 1.15e-1 SMART
low complexity region 1697 1730 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adal T A 2: 120,978,794 (GRCm39) I138N probably damaging Het
Arfgap1 T C 2: 180,613,478 (GRCm39) probably null Het
Boc T C 16: 44,313,188 (GRCm39) T559A probably damaging Het
Brip1 A G 11: 86,001,267 (GRCm39) V723A possibly damaging Het
Cnot10 A C 9: 114,444,123 (GRCm39) I424S probably benign Het
Cntnap4 T G 8: 113,529,858 (GRCm39) S689A probably benign Het
Cuzd1 A T 7: 130,911,460 (GRCm39) N506K possibly damaging Het
Dctn3 T A 4: 41,715,259 (GRCm39) T158S possibly damaging Het
Dnai2 A G 11: 114,635,917 (GRCm39) I301V probably benign Het
Ebpl G T 14: 61,578,695 (GRCm39) P180Q probably damaging Het
Epha5 T A 5: 84,254,649 (GRCm39) Y489F probably damaging Het
Frmd8 T C 19: 5,915,208 (GRCm39) N232S probably benign Het
Fuca1 T C 4: 135,660,267 (GRCm39) Y262H probably damaging Het
Gfy T C 7: 44,826,975 (GRCm39) I374V possibly damaging Het
Glg1 G A 8: 111,914,513 (GRCm39) R424C probably damaging Het
Ica1 G T 6: 8,742,288 (GRCm39) T115K probably damaging Het
Igf2bp2 T C 16: 21,879,586 (GRCm39) E511G probably damaging Het
Jag2 C A 12: 112,874,161 (GRCm39) R998L probably damaging Het
Kcnv1 G T 15: 44,972,513 (GRCm39) L457I probably damaging Het
Mroh2a C A 1: 88,170,142 (GRCm39) A685D possibly damaging Het
Ms4a8a T A 19: 11,053,743 (GRCm39) H121L probably damaging Het
Muc5b T A 7: 141,412,600 (GRCm39) S1849T unknown Het
Myo10 T C 15: 25,781,496 (GRCm39) V997A possibly damaging Het
Or10g3b A G 14: 52,587,156 (GRCm39) Y116H probably damaging Het
Or10g9b T A 9: 39,917,844 (GRCm39) M134L probably benign Het
Or8g54 T A 9: 39,706,905 (GRCm39) I78N probably benign Het
Pate2 T A 9: 35,581,801 (GRCm39) C32S probably damaging Het
Per1 G T 11: 68,992,284 (GRCm39) Q179H probably damaging Het
Pierce1 TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC TCTCTGGGGCAGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTCTGGGGCGGGCTTAGCCTTGGGCTCCCCCGGCTCCGGCTCCTC 2: 28,356,122 (GRCm39) probably benign Het
Rbp2 T A 9: 98,391,614 (GRCm39) V130E probably damaging Het
Rictor T A 15: 6,825,517 (GRCm39) probably null Het
Rundc3a A T 11: 102,289,287 (GRCm39) R153* probably null Het
Scrn3 C T 2: 73,149,826 (GRCm39) A174V probably damaging Het
Serpina10 T A 12: 103,594,619 (GRCm39) Q200L probably benign Het
Slc25a51 A T 4: 45,399,365 (GRCm39) I275N possibly damaging Het
Spast C T 17: 74,674,281 (GRCm39) H238Y possibly damaging Het
Speg A T 1: 75,368,456 (GRCm39) I775F possibly damaging Het
Ssh1 G T 5: 114,084,851 (GRCm39) T463K probably benign Het
Tm2d3 A G 7: 65,347,526 (GRCm39) E151G probably damaging Het
Uggt2 A G 14: 119,263,847 (GRCm39) I1061T probably damaging Het
Unc79 T G 12: 103,108,267 (GRCm39) S1941A probably benign Het
Vcan T C 13: 89,853,244 (GRCm39) D572G probably benign Het
Vmn2r16 T G 5: 109,488,412 (GRCm39) S428R probably benign Het
Zeb1 A G 18: 5,591,917 (GRCm39) D3G probably damaging Het
Zfp352 A G 4: 90,112,936 (GRCm39) T359A probably benign Het
Zfp987 C A 4: 146,062,315 (GRCm39) D582E probably benign Het
Zg16 G A 7: 126,649,692 (GRCm39) P90S possibly damaging Het
Other mutations in Abca17
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Abca17 APN 17 24,514,165 (GRCm39) missense probably benign 0.14
IGL00585:Abca17 APN 17 24,519,294 (GRCm39) missense probably damaging 0.99
IGL00941:Abca17 APN 17 24,536,104 (GRCm39) missense probably damaging 1.00
IGL01987:Abca17 APN 17 24,565,202 (GRCm39) missense probably benign 0.00
IGL01988:Abca17 APN 17 24,553,229 (GRCm39) missense probably damaging 0.99
IGL02223:Abca17 APN 17 24,506,909 (GRCm39) nonsense probably null
IGL02368:Abca17 APN 17 24,506,767 (GRCm39) missense probably benign 0.01
IGL02405:Abca17 APN 17 24,498,036 (GRCm39) missense possibly damaging 0.80
IGL02431:Abca17 APN 17 24,517,958 (GRCm39) missense probably benign 0.05
IGL02607:Abca17 APN 17 24,546,679 (GRCm39) nonsense probably null
IGL02706:Abca17 APN 17 24,517,966 (GRCm39) missense probably benign 0.00
IGL02729:Abca17 APN 17 24,499,455 (GRCm39) missense probably benign 0.06
IGL02818:Abca17 APN 17 24,519,326 (GRCm39) missense probably benign 0.02
IGL02891:Abca17 APN 17 24,500,340 (GRCm39) missense probably damaging 0.99
IGL03236:Abca17 APN 17 24,545,450 (GRCm39) splice site probably benign
IGL03299:Abca17 APN 17 24,484,565 (GRCm39) missense probably damaging 1.00
basin UTSW 17 24,537,159 (GRCm39) missense probably benign 0.01
Bowl UTSW 17 24,536,212 (GRCm39) missense probably benign 0.09
R0018:Abca17 UTSW 17 24,532,162 (GRCm39) splice site probably null
R0467:Abca17 UTSW 17 24,532,151 (GRCm39) splice site probably benign
R0671:Abca17 UTSW 17 24,500,223 (GRCm39) missense probably benign 0.00
R1175:Abca17 UTSW 17 24,508,325 (GRCm39) missense possibly damaging 0.91
R1397:Abca17 UTSW 17 24,504,733 (GRCm39) missense probably benign 0.18
R1398:Abca17 UTSW 17 24,547,511 (GRCm39) missense probably damaging 0.96
R1678:Abca17 UTSW 17 24,554,594 (GRCm39) missense probably benign 0.05
R1696:Abca17 UTSW 17 24,486,632 (GRCm39) missense possibly damaging 0.90
R1781:Abca17 UTSW 17 24,486,531 (GRCm39) missense possibly damaging 0.95
R1845:Abca17 UTSW 17 24,486,690 (GRCm39) missense probably damaging 1.00
R1970:Abca17 UTSW 17 24,526,549 (GRCm39) missense probably benign 0.00
R1997:Abca17 UTSW 17 24,504,700 (GRCm39) missense probably benign 0.02
R2141:Abca17 UTSW 17 24,553,240 (GRCm39) missense probably benign 0.00
R2199:Abca17 UTSW 17 24,554,598 (GRCm39) missense probably benign 0.19
R2394:Abca17 UTSW 17 24,500,190 (GRCm39) splice site probably null
R2442:Abca17 UTSW 17 24,547,606 (GRCm39) missense probably benign 0.02
R2509:Abca17 UTSW 17 24,508,587 (GRCm39) splice site probably benign
R2848:Abca17 UTSW 17 24,508,481 (GRCm39) missense probably damaging 0.96
R2849:Abca17 UTSW 17 24,508,481 (GRCm39) missense probably damaging 0.96
R2859:Abca17 UTSW 17 24,500,288 (GRCm39) missense possibly damaging 0.46
R2879:Abca17 UTSW 17 24,508,481 (GRCm39) missense probably damaging 0.96
R2935:Abca17 UTSW 17 24,508,481 (GRCm39) missense probably damaging 0.96
R3153:Abca17 UTSW 17 24,547,720 (GRCm39) missense probably damaging 1.00
R3154:Abca17 UTSW 17 24,547,720 (GRCm39) missense probably damaging 1.00
R3434:Abca17 UTSW 17 24,508,511 (GRCm39) missense probably damaging 1.00
R3695:Abca17 UTSW 17 24,508,481 (GRCm39) missense probably damaging 0.96
R3905:Abca17 UTSW 17 24,515,257 (GRCm39) missense probably benign 0.13
R4282:Abca17 UTSW 17 24,518,034 (GRCm39) missense possibly damaging 0.49
R4334:Abca17 UTSW 17 24,537,242 (GRCm39) missense probably damaging 1.00
R4350:Abca17 UTSW 17 24,498,020 (GRCm39) critical splice donor site probably null
R4548:Abca17 UTSW 17 24,553,245 (GRCm39) missense possibly damaging 0.82
R4626:Abca17 UTSW 17 24,540,058 (GRCm39) missense probably damaging 1.00
R4722:Abca17 UTSW 17 24,484,403 (GRCm39) missense probably damaging 1.00
R4745:Abca17 UTSW 17 24,526,427 (GRCm39) missense probably damaging 1.00
R4818:Abca17 UTSW 17 24,536,135 (GRCm39) missense probably damaging 0.98
R5279:Abca17 UTSW 17 24,508,388 (GRCm39) missense probably damaging 1.00
R5310:Abca17 UTSW 17 24,500,204 (GRCm39) missense probably benign 0.00
R5320:Abca17 UTSW 17 24,526,541 (GRCm39) missense probably damaging 1.00
R5435:Abca17 UTSW 17 24,486,588 (GRCm39) missense possibly damaging 0.90
R5622:Abca17 UTSW 17 24,546,642 (GRCm39) missense probably benign 0.14
R5776:Abca17 UTSW 17 24,514,132 (GRCm39) missense probably benign 0.09
R5928:Abca17 UTSW 17 24,537,159 (GRCm39) missense probably benign 0.01
R6013:Abca17 UTSW 17 24,506,820 (GRCm39) missense possibly damaging 0.79
R6035:Abca17 UTSW 17 24,500,219 (GRCm39) missense possibly damaging 0.79
R6035:Abca17 UTSW 17 24,500,219 (GRCm39) missense possibly damaging 0.79
R6052:Abca17 UTSW 17 24,537,165 (GRCm39) missense probably benign 0.00
R6063:Abca17 UTSW 17 24,483,318 (GRCm39) missense unknown
R6404:Abca17 UTSW 17 24,484,892 (GRCm39) missense probably benign 0.13
R6746:Abca17 UTSW 17 24,565,195 (GRCm39) nonsense probably null
R6828:Abca17 UTSW 17 24,545,389 (GRCm39) missense possibly damaging 0.91
R7043:Abca17 UTSW 17 24,484,474 (GRCm39) missense probably damaging 1.00
R7065:Abca17 UTSW 17 24,546,725 (GRCm39) missense probably damaging 1.00
R7123:Abca17 UTSW 17 24,484,949 (GRCm39) missense probably damaging 1.00
R7157:Abca17 UTSW 17 24,554,564 (GRCm39) missense possibly damaging 0.46
R7188:Abca17 UTSW 17 24,554,600 (GRCm39) missense possibly damaging 0.89
R7294:Abca17 UTSW 17 24,539,983 (GRCm39) missense not run
R7352:Abca17 UTSW 17 24,508,028 (GRCm39) nonsense probably null
R7355:Abca17 UTSW 17 24,486,621 (GRCm39) missense probably benign 0.00
R7358:Abca17 UTSW 17 24,510,529 (GRCm39) missense probably benign 0.00
R7411:Abca17 UTSW 17 24,547,543 (GRCm39) missense possibly damaging 0.52
R7915:Abca17 UTSW 17 24,484,507 (GRCm39) missense probably damaging 1.00
R8039:Abca17 UTSW 17 24,547,699 (GRCm39) missense probably damaging 1.00
R8095:Abca17 UTSW 17 24,536,196 (GRCm39) missense possibly damaging 0.77
R8308:Abca17 UTSW 17 24,486,657 (GRCm39) missense probably damaging 1.00
R8517:Abca17 UTSW 17 24,536,207 (GRCm39) missense probably benign 0.00
R8811:Abca17 UTSW 17 24,536,212 (GRCm39) missense probably benign 0.09
R8819:Abca17 UTSW 17 24,547,576 (GRCm39) missense probably damaging 1.00
R8820:Abca17 UTSW 17 24,547,576 (GRCm39) missense probably damaging 1.00
R8953:Abca17 UTSW 17 24,518,015 (GRCm39) missense probably benign
R9095:Abca17 UTSW 17 24,500,370 (GRCm39) missense probably damaging 0.97
R9313:Abca17 UTSW 17 24,565,207 (GRCm39) missense probably benign 0.00
R9314:Abca17 UTSW 17 24,547,593 (GRCm39) missense possibly damaging 0.91
R9347:Abca17 UTSW 17 24,483,479 (GRCm39) missense probably benign
R9351:Abca17 UTSW 17 24,510,751 (GRCm39) missense probably benign 0.00
R9387:Abca17 UTSW 17 24,553,255 (GRCm39) missense probably benign 0.02
R9388:Abca17 UTSW 17 24,483,273 (GRCm39) missense unknown
R9440:Abca17 UTSW 17 24,499,452 (GRCm39) missense probably benign 0.02
R9498:Abca17 UTSW 17 24,484,480 (GRCm39) missense probably damaging 1.00
R9654:Abca17 UTSW 17 24,536,099 (GRCm39) missense probably benign 0.09
R9709:Abca17 UTSW 17 24,517,934 (GRCm39) missense probably benign
R9770:Abca17 UTSW 17 24,514,121 (GRCm39) missense probably benign 0.00
R9773:Abca17 UTSW 17 24,508,565 (GRCm39) missense probably damaging 1.00
RF024:Abca17 UTSW 17 24,506,706 (GRCm39) frame shift probably null
RF029:Abca17 UTSW 17 24,506,701 (GRCm39) critical splice donor site probably benign
RF032:Abca17 UTSW 17 24,506,701 (GRCm39) frame shift probably null
RF036:Abca17 UTSW 17 24,506,701 (GRCm39) critical splice donor site probably benign
X0017:Abca17 UTSW 17 24,536,137 (GRCm39) missense probably benign 0.26
X0065:Abca17 UTSW 17 24,553,258 (GRCm39) missense probably damaging 1.00
Z1088:Abca17 UTSW 17 24,498,081 (GRCm39) missense probably benign 0.03
Z1088:Abca17 UTSW 17 24,498,053 (GRCm39) missense probably damaging 0.96
Z1088:Abca17 UTSW 17 24,565,193 (GRCm39) missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGAGTTGTTTGTCCACCCTG -3'
(R):5'- GGATGAACCCTTACGGACTC -3'

Sequencing Primer
(F):5'- TGTGTTCGGCCCACAGC -3'
(R):5'- GATGAACCCTTACGGACTCTTCCC -3'
Posted On 2018-10-18