Incidental Mutation 'R6820:Itih2'
ID537549
Institutional Source Beutler Lab
Gene Symbol Itih2
Ensembl Gene ENSMUSG00000037254
Gene Nameinter-alpha trypsin inhibitor, heavy chain 2
SynonymsItih-2, Intin2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.126) question?
Stock #R6820 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location10094593-10131396 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 10098098 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 742 (I742V)
Ref Sequence ENSEMBL: ENSMUSP00000046530 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042290]
Predicted Effect probably benign
Transcript: ENSMUST00000042290
AA Change: I742V

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000046530
Gene: ENSMUSG00000037254
AA Change: I742V

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
VIT 60 189 4.35e-77 SMART
VWA 312 498 6.6e-32 SMART
Pfam:ITI_HC_C 740 925 1.7e-75 PFAM
Meta Mutation Damage Score 0.1255 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The inter-alpha-trypsin inhibitors (ITI) are a family of structurally related plasma serine protease inhibitors involved in extracellular matrix stabilization and in prevention of tumor metastasis. The ITI family contains multiple proteins made up of a light chain (see MIM 176870) and a variable number of heavy chains (Salier et al., 1987 [PubMed 2446322]; Himmelfarb et al., 2004 [PubMed 14744536]).[supplied by OMIM, Nov 2009]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Accs T A 2: 93,842,921 N141Y probably null Het
Chkb A G 15: 89,428,176 L46P probably damaging Het
Col9a3 G A 2: 180,607,134 V260M probably damaging Het
Dna2 T C 10: 62,964,904 I739T possibly damaging Het
Dnah17 T C 11: 118,069,000 H2620R probably damaging Het
Dsel A G 1: 111,859,817 V996A probably damaging Het
Dst T C 1: 34,211,256 L1757S probably damaging Het
Exoc5 A T 14: 49,048,930 probably null Het
Fam120a A T 13: 48,880,992 V1048E possibly damaging Het
Fam213b A T 4: 154,898,166 D50E probably damaging Het
Fam50b G A 13: 34,747,101 E187K possibly damaging Het
Fbxw19 T A 9: 109,482,011 T377S probably benign Het
Fbxw28 A T 9: 109,338,425 F88Y probably damaging Het
Grik5 C T 7: 25,046,355 R431Q possibly damaging Het
Gtsf1 T C 15: 103,420,527 T92A probably benign Het
Hoxc13 A G 15: 102,921,822 Y212C probably damaging Het
Kat7 T C 11: 95,284,139 T351A probably damaging Het
Mlh3 T C 12: 85,247,723 D1233G probably damaging Het
Mroh2b A G 15: 4,953,274 D1525G probably damaging Het
Nme5 T C 18: 34,571,573 Y73C probably damaging Het
Nr3c2 T C 8: 77,242,457 V957A probably damaging Het
Nup153 A G 13: 46,709,983 S301P probably benign Het
Obscn T C 11: 59,051,193 D5013G probably damaging Het
Olfr1278 C T 2: 111,293,110 P281S probably damaging Het
Olfr470 A G 7: 107,845,091 V214A probably benign Het
Olfr919 A G 9: 38,697,475 V297A possibly damaging Het
Pak1 A G 7: 97,886,379 N226D probably benign Het
Pak4 A G 7: 28,563,036 Y384H probably benign Het
Pkp3 T C 7: 141,079,844 probably null Het
Psd G T 19: 46,320,844 A558E probably damaging Het
Psmd14 C A 2: 61,776,724 H172N probably benign Het
Pygb G T 2: 150,816,754 W366L possibly damaging Het
Rbm39 A T 2: 156,179,226 M1K probably null Het
Rnf213 T C 11: 119,448,838 I3421T probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Smg6 T C 11: 75,041,964 V88A probably damaging Het
Tha1 T C 11: 117,871,678 E80G probably benign Het
Tie1 A G 4: 118,484,386 V243A probably damaging Het
Tmem215 T C 4: 40,473,926 M1T probably null Het
Tpm2 A G 4: 43,518,443 Y221H probably damaging Het
Ubap1 C T 4: 41,379,854 P356L probably benign Het
Wbp2nl G T 15: 82,313,795 A178S possibly damaging Het
Wdr54 A T 6: 83,154,619 S139T probably benign Het
Wipi2 G C 5: 142,629,800 Q14H probably benign Het
Zan T C 5: 137,407,844 probably benign Het
Zfp735 A G 11: 73,688,957 M1V probably null Het
Other mutations in Itih2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01641:Itih2 APN 2 10110439 missense probably benign 0.00
IGL01775:Itih2 APN 2 10129286 missense probably benign 0.19
IGL02516:Itih2 APN 2 10097917 missense probably benign 0.00
IGL02698:Itih2 APN 2 10130501 missense probably damaging 1.00
IGL02747:Itih2 APN 2 10097945 missense probably benign 0.35
IGL03162:Itih2 APN 2 10126244 missense probably damaging 1.00
IGL03325:Itih2 APN 2 10106735 missense probably damaging 1.00
R0226:Itih2 UTSW 2 10115299 missense possibly damaging 0.71
R0316:Itih2 UTSW 2 10105246 missense possibly damaging 0.67
R0415:Itih2 UTSW 2 10105615 unclassified probably benign
R0612:Itih2 UTSW 2 10117394 missense probably benign 0.16
R0625:Itih2 UTSW 2 10123414 missense possibly damaging 0.49
R0766:Itih2 UTSW 2 10097924 missense probably benign 0.21
R1312:Itih2 UTSW 2 10097924 missense probably benign 0.21
R1322:Itih2 UTSW 2 10109522 missense probably damaging 1.00
R1521:Itih2 UTSW 2 10106747 missense probably damaging 1.00
R1544:Itih2 UTSW 2 10105214 missense probably benign 0.27
R1622:Itih2 UTSW 2 10102079 missense probably benign 0.00
R1649:Itih2 UTSW 2 10105735 missense probably benign 0.37
R2064:Itih2 UTSW 2 10130574 missense possibly damaging 0.83
R2378:Itih2 UTSW 2 10094887 missense probably damaging 1.00
R2893:Itih2 UTSW 2 10102197 missense possibly damaging 0.79
R3732:Itih2 UTSW 2 10105670 missense probably benign 0.00
R3732:Itih2 UTSW 2 10105670 missense probably benign 0.00
R3733:Itih2 UTSW 2 10105670 missense probably benign 0.00
R4195:Itih2 UTSW 2 10115285 missense probably damaging 1.00
R4405:Itih2 UTSW 2 10106737 nonsense probably null
R4585:Itih2 UTSW 2 10110400 missense probably benign 0.00
R4586:Itih2 UTSW 2 10110400 missense probably benign 0.00
R4610:Itih2 UTSW 2 10105160 missense probably damaging 0.96
R5311:Itih2 UTSW 2 10110535 missense probably benign 0.01
R5361:Itih2 UTSW 2 10096461 missense probably benign 0.09
R5436:Itih2 UTSW 2 10105196 missense probably benign 0.00
R5454:Itih2 UTSW 2 10097993 missense probably null 0.00
R5580:Itih2 UTSW 2 10123476 missense probably damaging 1.00
R5621:Itih2 UTSW 2 10102805 missense probably benign 0.00
R5846:Itih2 UTSW 2 10097903 missense probably benign 0.00
R6083:Itih2 UTSW 2 10108894 intron probably benign
R6190:Itih2 UTSW 2 10098507 missense probably benign 0.37
R6198:Itih2 UTSW 2 10098541 missense probably benign 0.00
R6469:Itih2 UTSW 2 10123413 missense possibly damaging 0.65
R6816:Itih2 UTSW 2 10105706 missense probably damaging 1.00
R6853:Itih2 UTSW 2 10115266 missense probably damaging 1.00
R7102:Itih2 UTSW 2 10105763 missense probably benign 0.27
R7173:Itih2 UTSW 2 10105163 missense probably damaging 1.00
R7387:Itih2 UTSW 2 10130508 missense possibly damaging 0.63
RF012:Itih2 UTSW 2 10117403 missense possibly damaging 0.72
Predicted Primers PCR Primer
(F):5'- AAGATGAGCTGTGTCGGACC -3'
(R):5'- GACGGCTAGACTTCCTTGTG -3'

Sequencing Primer
(F):5'- TGTGTCGGACCAGGACAGTC -3'
(R):5'- TCTCACCCCATTAGATAGACTATAGC -3'
Posted On2018-10-18