Incidental Mutation 'R6820:Olfr1278'
ID537552
Institutional Source Beutler Lab
Gene Symbol Olfr1278
Ensembl Gene ENSMUSG00000068647
Gene Nameolfactory receptor 1278
SynonymsGA_x6K02T2Q125-72343713-72344654, MOR245-11
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R6820 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location111290136-111298886 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 111293110 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 281 (P281S)
Ref Sequence ENSEMBL: ENSMUSP00000150587 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090330] [ENSMUST00000213516] [ENSMUST00000213727] [ENSMUST00000214669] [ENSMUST00000215210] [ENSMUST00000216229]
Predicted Effect probably damaging
Transcript: ENSMUST00000090330
AA Change: P281S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000087802
Gene: ENSMUSG00000068647
AA Change: P281S

DomainStartEndE-ValueType
Pfam:7tm_4 30 306 2.3e-43 PFAM
Pfam:7TM_GPCR_Srsx 35 281 5.3e-6 PFAM
Pfam:7tm_1 41 288 1.1e-23 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213516
AA Change: P281S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000213727
AA Change: P281S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000214669
AA Change: P281S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000215210
AA Change: P281S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000216229
AA Change: P281S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Accs T A 2: 93,842,921 N141Y probably null Het
Chkb A G 15: 89,428,176 L46P probably damaging Het
Col9a3 G A 2: 180,607,134 V260M probably damaging Het
Dna2 T C 10: 62,964,904 I739T possibly damaging Het
Dnah17 T C 11: 118,069,000 H2620R probably damaging Het
Dsel A G 1: 111,859,817 V996A probably damaging Het
Dst T C 1: 34,211,256 L1757S probably damaging Het
Exoc5 A T 14: 49,048,930 probably null Het
Fam120a A T 13: 48,880,992 V1048E possibly damaging Het
Fam213b A T 4: 154,898,166 D50E probably damaging Het
Fam50b G A 13: 34,747,101 E187K possibly damaging Het
Fbxw19 T A 9: 109,482,011 T377S probably benign Het
Fbxw28 A T 9: 109,338,425 F88Y probably damaging Het
Grik5 C T 7: 25,046,355 R431Q possibly damaging Het
Gtsf1 T C 15: 103,420,527 T92A probably benign Het
Hoxc13 A G 15: 102,921,822 Y212C probably damaging Het
Itih2 T C 2: 10,098,098 I742V probably benign Het
Kat7 T C 11: 95,284,139 T351A probably damaging Het
Mlh3 T C 12: 85,247,723 D1233G probably damaging Het
Mroh2b A G 15: 4,953,274 D1525G probably damaging Het
Nme5 T C 18: 34,571,573 Y73C probably damaging Het
Nr3c2 T C 8: 77,242,457 V957A probably damaging Het
Nup153 A G 13: 46,709,983 S301P probably benign Het
Obscn T C 11: 59,051,193 D5013G probably damaging Het
Olfr470 A G 7: 107,845,091 V214A probably benign Het
Olfr919 A G 9: 38,697,475 V297A possibly damaging Het
Pak1 A G 7: 97,886,379 N226D probably benign Het
Pak4 A G 7: 28,563,036 Y384H probably benign Het
Pkp3 T C 7: 141,079,844 probably null Het
Psd G T 19: 46,320,844 A558E probably damaging Het
Psmd14 C A 2: 61,776,724 H172N probably benign Het
Pygb G T 2: 150,816,754 W366L possibly damaging Het
Rbm39 A T 2: 156,179,226 M1K probably null Het
Rnf213 T C 11: 119,448,838 I3421T probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Smg6 T C 11: 75,041,964 V88A probably damaging Het
Tha1 T C 11: 117,871,678 E80G probably benign Het
Tie1 A G 4: 118,484,386 V243A probably damaging Het
Tmem215 T C 4: 40,473,926 M1T probably null Het
Tpm2 A G 4: 43,518,443 Y221H probably damaging Het
Ubap1 C T 4: 41,379,854 P356L probably benign Het
Wbp2nl G T 15: 82,313,795 A178S possibly damaging Het
Wdr54 A T 6: 83,154,619 S139T probably benign Het
Wipi2 G C 5: 142,629,800 Q14H probably benign Het
Zan T C 5: 137,407,844 probably benign Het
Zfp735 A G 11: 73,688,957 M1V probably null Het
Other mutations in Olfr1278
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01109:Olfr1278 APN 2 111292519 missense probably benign 0.11
IGL02301:Olfr1278 APN 2 111292697 missense probably benign 0.03
IGL02480:Olfr1278 APN 2 111292513 missense possibly damaging 0.66
IGL03056:Olfr1278 APN 2 111293172 missense possibly damaging 0.90
IGL03327:Olfr1278 APN 2 111292462 missense probably damaging 1.00
R0284:Olfr1278 UTSW 2 111292586 missense probably benign 0.34
R1614:Olfr1278 UTSW 2 111293066 missense probably damaging 0.97
R1698:Olfr1278 UTSW 2 111292560 nonsense probably null
R1733:Olfr1278 UTSW 2 111292865 missense probably damaging 0.98
R2265:Olfr1278 UTSW 2 111293179 missense probably benign 0.01
R4857:Olfr1278 UTSW 2 111293143 missense possibly damaging 0.95
R5061:Olfr1278 UTSW 2 111292487 missense probably damaging 1.00
R5208:Olfr1278 UTSW 2 111292601 missense probably damaging 1.00
R5940:Olfr1278 UTSW 2 111292384 missense possibly damaging 0.80
R6355:Olfr1278 UTSW 2 111292885 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- CAACAGTGGGTTTATTTCCATGGG -3'
(R):5'- TGCCTCAGCATAGCAGTATTC -3'

Sequencing Primer
(F):5'- GGCACCTTTTTGTTATTGATAATCTC -3'
(R):5'- CCTCAGCATAGCAGTATTCAGTTATG -3'
Posted On2018-10-18