Incidental Mutation 'R6820:Col9a3'
ID537555
Institutional Source Beutler Lab
Gene Symbol Col9a3
Ensembl Gene ENSMUSG00000027570
Gene Namecollagen, type IX, alpha 3
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.299) question?
Stock #R6820 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location180597790-180622189 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 180607134 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 260 (V260M)
Ref Sequence ENSEMBL: ENSMUSP00000128718 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103059] [ENSMUST00000132527]
Predicted Effect probably damaging
Transcript: ENSMUST00000103059
AA Change: V260M

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000099348
Gene: ENSMUSG00000027570
AA Change: V260M

DomainStartEndE-ValueType
Pfam:Collagen 21 80 7.7e-12 PFAM
Pfam:Collagen 58 114 4.2e-9 PFAM
low complexity region 126 162 N/A INTRINSIC
Pfam:Collagen 174 236 4.1e-12 PFAM
Pfam:Collagen 213 292 8e-9 PFAM
internal_repeat_1 315 366 1.58e-12 PROSPERO
internal_repeat_2 360 382 2.94e-6 PROSPERO
low complexity region 384 396 N/A INTRINSIC
Pfam:Collagen 456 518 1.8e-11 PFAM
Pfam:Collagen 545 606 3.8e-11 PFAM
low complexity region 635 656 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129090
Predicted Effect probably damaging
Transcript: ENSMUST00000132527
AA Change: V260M

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000128718
Gene: ENSMUSG00000027570
AA Change: V260M

DomainStartEndE-ValueType
Pfam:Collagen 21 80 7.9e-12 PFAM
Pfam:Collagen 58 114 4.3e-9 PFAM
Pfam:Collagen 109 166 4.5e-8 PFAM
Pfam:Collagen 174 236 4.2e-12 PFAM
Pfam:Collagen 213 292 8.2e-9 PFAM
internal_repeat_1 315 366 1.58e-12 PROSPERO
internal_repeat_2 360 382 2.94e-6 PROSPERO
low complexity region 384 396 N/A INTRINSIC
Pfam:Collagen 402 474 8.2e-8 PFAM
Pfam:Collagen 456 518 1.8e-11 PFAM
Pfam:Collagen 545 606 3.9e-11 PFAM
Pfam:Collagen 603 662 2.5e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141056
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the three alpha chains of type IX collagen, the major collagen component of hyaline cartilage. Type IX collagen, a heterotrimeric molecule, is usually found in tissues containing type II collagen, a fibrillar collagen. Mutations in this gene are associated with multiple epiphyseal dysplasia type 3. [provided by RefSeq, Jan 2010]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Accs T A 2: 93,842,921 N141Y probably null Het
Chkb A G 15: 89,428,176 L46P probably damaging Het
Dna2 T C 10: 62,964,904 I739T possibly damaging Het
Dnah17 T C 11: 118,069,000 H2620R probably damaging Het
Dsel A G 1: 111,859,817 V996A probably damaging Het
Dst T C 1: 34,211,256 L1757S probably damaging Het
Exoc5 A T 14: 49,048,930 probably null Het
Fam120a A T 13: 48,880,992 V1048E possibly damaging Het
Fam213b A T 4: 154,898,166 D50E probably damaging Het
Fam50b G A 13: 34,747,101 E187K possibly damaging Het
Fbxw19 T A 9: 109,482,011 T377S probably benign Het
Fbxw28 A T 9: 109,338,425 F88Y probably damaging Het
Grik5 C T 7: 25,046,355 R431Q possibly damaging Het
Gtsf1 T C 15: 103,420,527 T92A probably benign Het
Hoxc13 A G 15: 102,921,822 Y212C probably damaging Het
Itih2 T C 2: 10,098,098 I742V probably benign Het
Kat7 T C 11: 95,284,139 T351A probably damaging Het
Mlh3 T C 12: 85,247,723 D1233G probably damaging Het
Mroh2b A G 15: 4,953,274 D1525G probably damaging Het
Nme5 T C 18: 34,571,573 Y73C probably damaging Het
Nr3c2 T C 8: 77,242,457 V957A probably damaging Het
Nup153 A G 13: 46,709,983 S301P probably benign Het
Obscn T C 11: 59,051,193 D5013G probably damaging Het
Olfr1278 C T 2: 111,293,110 P281S probably damaging Het
Olfr470 A G 7: 107,845,091 V214A probably benign Het
Olfr919 A G 9: 38,697,475 V297A possibly damaging Het
Pak1 A G 7: 97,886,379 N226D probably benign Het
Pak4 A G 7: 28,563,036 Y384H probably benign Het
Pkp3 T C 7: 141,079,844 probably null Het
Psd G T 19: 46,320,844 A558E probably damaging Het
Psmd14 C A 2: 61,776,724 H172N probably benign Het
Pygb G T 2: 150,816,754 W366L possibly damaging Het
Rbm39 A T 2: 156,179,226 M1K probably null Het
Rnf213 T C 11: 119,448,838 I3421T probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Smg6 T C 11: 75,041,964 V88A probably damaging Het
Tha1 T C 11: 117,871,678 E80G probably benign Het
Tie1 A G 4: 118,484,386 V243A probably damaging Het
Tmem215 T C 4: 40,473,926 M1T probably null Het
Tpm2 A G 4: 43,518,443 Y221H probably damaging Het
Ubap1 C T 4: 41,379,854 P356L probably benign Het
Wbp2nl G T 15: 82,313,795 A178S possibly damaging Het
Wdr54 A T 6: 83,154,619 S139T probably benign Het
Wipi2 G C 5: 142,629,800 Q14H probably benign Het
Zan T C 5: 137,407,844 probably benign Het
Zfp735 A G 11: 73,688,957 M1V probably null Het
Other mutations in Col9a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01022:Col9a3 APN 2 180616434 missense probably damaging 0.96
IGL01542:Col9a3 APN 2 180609316 splice site probably benign
IGL01727:Col9a3 APN 2 180616565 critical splice donor site probably null
IGL02558:Col9a3 APN 2 180606806 critical splice acceptor site probably null
IGL03112:Col9a3 APN 2 180607642 missense possibly damaging 0.60
IGL02796:Col9a3 UTSW 2 180614162 missense probably damaging 1.00
R0022:Col9a3 UTSW 2 180619756 missense probably damaging 1.00
R0022:Col9a3 UTSW 2 180619756 missense probably damaging 1.00
R0046:Col9a3 UTSW 2 180609487 missense possibly damaging 0.47
R0046:Col9a3 UTSW 2 180609487 missense possibly damaging 0.47
R0477:Col9a3 UTSW 2 180609470 splice site probably benign
R0890:Col9a3 UTSW 2 180610063 missense probably benign 0.23
R1934:Col9a3 UTSW 2 180607134 missense probably damaging 0.98
R4355:Col9a3 UTSW 2 180606478 missense probably benign 0.00
R4571:Col9a3 UTSW 2 180616366 splice site probably benign
R4688:Col9a3 UTSW 2 180607631 missense probably damaging 0.99
R4731:Col9a3 UTSW 2 180610681 missense probably damaging 0.99
R4742:Col9a3 UTSW 2 180603387 missense unknown
R4847:Col9a3 UTSW 2 180615525 missense probably damaging 1.00
R4985:Col9a3 UTSW 2 180603400 missense unknown
R5488:Col9a3 UTSW 2 180616525 missense probably damaging 1.00
R5489:Col9a3 UTSW 2 180616525 missense probably damaging 1.00
R5573:Col9a3 UTSW 2 180619732 missense probably benign 0.17
R5575:Col9a3 UTSW 2 180598846 intron probably benign
R7114:Col9a3 UTSW 2 180603797 missense unknown
R7710:Col9a3 UTSW 2 180609365 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GTCTCACCAGTCAGCATCAC -3'
(R):5'- ATCGGCATGCCACATTGTCC -3'

Sequencing Primer
(F):5'- ACCAAAGCTCTTCCTGGCTGG -3'
(R):5'- GTGCCCTGGACCTCATGGATATAC -3'
Posted On2018-10-18