Incidental Mutation 'R6820:Wipi2'
ID537562
Institutional Source Beutler Lab
Gene Symbol Wipi2
Ensembl Gene ENSMUSG00000029578
Gene NameWD repeat domain, phosphoinositide interacting 2
Synonyms1110018O08Rik, 2510001I10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.882) question?
Stock #R6820 (G1)
Quality Score177.009
Status Validated
Chromosome5
Chromosomal Location142627698-142670588 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 142629800 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Histidine at position 14 (Q14H)
Ref Sequence ENSEMBL: ENSMUSP00000045201 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036872] [ENSMUST00000110778]
Predicted Effect probably benign
Transcript: ENSMUST00000036872
AA Change: Q14H

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000045201
Gene: ENSMUSG00000029578
AA Change: Q14H

DomainStartEndE-ValueType
Blast:WD40 88 123 5e-14 BLAST
WD40 173 213 1.92e-1 SMART
WD40 216 258 1.99e0 SMART
WD40 298 340 4.75e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110778
AA Change: Q14H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000106405
Gene: ENSMUSG00000029578
AA Change: Q14H

DomainStartEndE-ValueType
Blast:WD40 88 123 6e-14 BLAST
WD40 173 213 1.92e-1 SMART
WD40 216 258 1.99e0 SMART
WD40 298 340 4.75e1 SMART
Meta Mutation Damage Score 0.0625 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] WD40 repeat proteins are key components of many essential biologic functions. They regulate the assembly of multiprotein complexes by presenting a beta-propeller platform for simultaneous and reversible protein-protein interactions. Members of the WIPI subfamily of WD40 repeat proteins, such as WIPI2, have a 7-bladed propeller structure and contain a conserved motif for interaction with phospholipids (Proikas-Cezanne et al., 2004 [PubMed 15602573]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Accs T A 2: 93,842,921 N141Y probably null Het
Chkb A G 15: 89,428,176 L46P probably damaging Het
Col9a3 G A 2: 180,607,134 V260M probably damaging Het
Dna2 T C 10: 62,964,904 I739T possibly damaging Het
Dnah17 T C 11: 118,069,000 H2620R probably damaging Het
Dsel A G 1: 111,859,817 V996A probably damaging Het
Dst T C 1: 34,211,256 L1757S probably damaging Het
Exoc5 A T 14: 49,048,930 probably null Het
Fam120a A T 13: 48,880,992 V1048E possibly damaging Het
Fam213b A T 4: 154,898,166 D50E probably damaging Het
Fam50b G A 13: 34,747,101 E187K possibly damaging Het
Fbxw19 T A 9: 109,482,011 T377S probably benign Het
Fbxw28 A T 9: 109,338,425 F88Y probably damaging Het
Grik5 C T 7: 25,046,355 R431Q possibly damaging Het
Gtsf1 T C 15: 103,420,527 T92A probably benign Het
Hoxc13 A G 15: 102,921,822 Y212C probably damaging Het
Itih2 T C 2: 10,098,098 I742V probably benign Het
Kat7 T C 11: 95,284,139 T351A probably damaging Het
Mlh3 T C 12: 85,247,723 D1233G probably damaging Het
Mroh2b A G 15: 4,953,274 D1525G probably damaging Het
Nme5 T C 18: 34,571,573 Y73C probably damaging Het
Nr3c2 T C 8: 77,242,457 V957A probably damaging Het
Nup153 A G 13: 46,709,983 S301P probably benign Het
Obscn T C 11: 59,051,193 D5013G probably damaging Het
Olfr1278 C T 2: 111,293,110 P281S probably damaging Het
Olfr470 A G 7: 107,845,091 V214A probably benign Het
Olfr919 A G 9: 38,697,475 V297A possibly damaging Het
Pak1 A G 7: 97,886,379 N226D probably benign Het
Pak4 A G 7: 28,563,036 Y384H probably benign Het
Pkp3 T C 7: 141,079,844 probably null Het
Psd G T 19: 46,320,844 A558E probably damaging Het
Psmd14 C A 2: 61,776,724 H172N probably benign Het
Pygb G T 2: 150,816,754 W366L possibly damaging Het
Rbm39 A T 2: 156,179,226 M1K probably null Het
Rnf213 T C 11: 119,448,838 I3421T probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Smg6 T C 11: 75,041,964 V88A probably damaging Het
Tha1 T C 11: 117,871,678 E80G probably benign Het
Tie1 A G 4: 118,484,386 V243A probably damaging Het
Tmem215 T C 4: 40,473,926 M1T probably null Het
Tpm2 A G 4: 43,518,443 Y221H probably damaging Het
Ubap1 C T 4: 41,379,854 P356L probably benign Het
Wbp2nl G T 15: 82,313,795 A178S possibly damaging Het
Wdr54 A T 6: 83,154,619 S139T probably benign Het
Zan T C 5: 137,407,844 probably benign Het
Zfp735 A G 11: 73,688,957 M1V probably null Het
Other mutations in Wipi2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00679:Wipi2 APN 5 142659149 missense probably damaging 1.00
IGL00737:Wipi2 APN 5 142666870 missense probably benign 0.00
IGL01388:Wipi2 APN 5 142661043 missense possibly damaging 0.82
IGL02523:Wipi2 APN 5 142661032 missense probably damaging 1.00
IGL02725:Wipi2 APN 5 142666863 missense possibly damaging 0.62
IGL03121:Wipi2 APN 5 142663102 missense probably benign 0.39
PIT4445001:Wipi2 UTSW 5 142666884 missense probably benign
R0677:Wipi2 UTSW 5 142658234 missense probably damaging 1.00
R1818:Wipi2 UTSW 5 142658208 missense probably damaging 1.00
R4670:Wipi2 UTSW 5 142659590 missense probably benign
R6414:Wipi2 UTSW 5 142655938 missense probably damaging 1.00
R7575:Wipi2 UTSW 5 142658232 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCGCACCTTTATGCATGC -3'
(R):5'- ACTTTGCGAAAGGCCAGGTC -3'

Sequencing Primer
(F):5'- ATGAGGCGGCAGTTGGTCC -3'
(R):5'- AAGGCCAGGTCTCAGGAC -3'
Posted On2018-10-18