Incidental Mutation 'R6820:Grik5'
ID537564
Institutional Source Beutler Lab
Gene Symbol Grik5
Ensembl Gene ENSMUSG00000003378
Gene Nameglutamate receptor, ionotropic, kainate 5 (gamma 2)
SynonymsGluRgamma2, KA2
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.184) question?
Stock #R6820 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location25009849-25072346 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 25046355 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 431 (R431Q)
Ref Sequence ENSEMBL: ENSMUSP00000003468 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003468] [ENSMUST00000205328] [ENSMUST00000206134]
Predicted Effect possibly damaging
Transcript: ENSMUST00000003468
AA Change: R431Q

PolyPhen 2 Score 0.456 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000003468
Gene: ENSMUSG00000003378
AA Change: R431Q

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 40 381 3.4e-64 PFAM
PBPe 416 785 3.7e-122 SMART
Lig_chan-Glu_bd 426 490 1.65e-29 SMART
transmembrane domain 804 823 N/A INTRINSIC
low complexity region 859 872 N/A INTRINSIC
low complexity region 893 921 N/A INTRINSIC
low complexity region 962 973 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000205328
Predicted Effect probably benign
Transcript: ENSMUST00000206134
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to the glutamate-gated ionic channel family. Glutamate functions as the major excitatory neurotransmitter in the central nervous system through activation of ligand-gated ion channels and G protein-coupled membrane receptors. The protein encoded by this gene forms functional heteromeric kainate-preferring ionic channels with the subunits encoded by related gene family members. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for one allele display abnormal hippocampal synapse function. Mice homozygous for a second allele display decreased thermal nociception, increased startle response and increased susceptibility to pharmacologically induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Accs T A 2: 93,842,921 N141Y probably null Het
Chkb A G 15: 89,428,176 L46P probably damaging Het
Col9a3 G A 2: 180,607,134 V260M probably damaging Het
Dna2 T C 10: 62,964,904 I739T possibly damaging Het
Dnah17 T C 11: 118,069,000 H2620R probably damaging Het
Dsel A G 1: 111,859,817 V996A probably damaging Het
Dst T C 1: 34,211,256 L1757S probably damaging Het
Exoc5 A T 14: 49,048,930 probably null Het
Fam120a A T 13: 48,880,992 V1048E possibly damaging Het
Fam213b A T 4: 154,898,166 D50E probably damaging Het
Fam50b G A 13: 34,747,101 E187K possibly damaging Het
Fbxw19 T A 9: 109,482,011 T377S probably benign Het
Fbxw28 A T 9: 109,338,425 F88Y probably damaging Het
Gtsf1 T C 15: 103,420,527 T92A probably benign Het
Hoxc13 A G 15: 102,921,822 Y212C probably damaging Het
Itih2 T C 2: 10,098,098 I742V probably benign Het
Kat7 T C 11: 95,284,139 T351A probably damaging Het
Mlh3 T C 12: 85,247,723 D1233G probably damaging Het
Mroh2b A G 15: 4,953,274 D1525G probably damaging Het
Nme5 T C 18: 34,571,573 Y73C probably damaging Het
Nr3c2 T C 8: 77,242,457 V957A probably damaging Het
Nup153 A G 13: 46,709,983 S301P probably benign Het
Obscn T C 11: 59,051,193 D5013G probably damaging Het
Olfr1278 C T 2: 111,293,110 P281S probably damaging Het
Olfr470 A G 7: 107,845,091 V214A probably benign Het
Olfr919 A G 9: 38,697,475 V297A possibly damaging Het
Pak1 A G 7: 97,886,379 N226D probably benign Het
Pak4 A G 7: 28,563,036 Y384H probably benign Het
Pkp3 T C 7: 141,079,844 probably null Het
Psd G T 19: 46,320,844 A558E probably damaging Het
Psmd14 C A 2: 61,776,724 H172N probably benign Het
Pygb G T 2: 150,816,754 W366L possibly damaging Het
Rbm39 A T 2: 156,179,226 M1K probably null Het
Rnf213 T C 11: 119,448,838 I3421T probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Smg6 T C 11: 75,041,964 V88A probably damaging Het
Tha1 T C 11: 117,871,678 E80G probably benign Het
Tie1 A G 4: 118,484,386 V243A probably damaging Het
Tmem215 T C 4: 40,473,926 M1T probably null Het
Tpm2 A G 4: 43,518,443 Y221H probably damaging Het
Ubap1 C T 4: 41,379,854 P356L probably benign Het
Wbp2nl G T 15: 82,313,795 A178S possibly damaging Het
Wdr54 A T 6: 83,154,619 S139T probably benign Het
Wipi2 G C 5: 142,629,800 Q14H probably benign Het
Zan T C 5: 137,407,844 probably benign Het
Zfp735 A G 11: 73,688,957 M1V probably null Het
Other mutations in Grik5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00788:Grik5 APN 7 25065393 missense probably damaging 1.00
IGL00974:Grik5 APN 7 25013885 missense probably damaging 1.00
IGL01941:Grik5 APN 7 25065182 missense probably damaging 1.00
IGL02642:Grik5 APN 7 25058983 missense possibly damaging 0.51
IGL03177:Grik5 APN 7 25015454 missense probably damaging 1.00
IGL03402:Grik5 APN 7 25015469 missense probably damaging 1.00
Griffin UTSW 7 25059077 missense possibly damaging 0.78
PIT4453001:Grik5 UTSW 7 25010694 missense probably damaging 0.99
R0077:Grik5 UTSW 7 25023380 missense probably damaging 1.00
R0412:Grik5 UTSW 7 25013674 missense possibly damaging 0.59
R0427:Grik5 UTSW 7 25058498 missense probably benign 0.34
R1191:Grik5 UTSW 7 25058325 nonsense probably null
R1830:Grik5 UTSW 7 25046301 missense possibly damaging 0.94
R2072:Grik5 UTSW 7 25015313 missense possibly damaging 0.92
R2369:Grik5 UTSW 7 25058537 missense probably damaging 1.00
R3410:Grik5 UTSW 7 25062972 missense probably benign 0.04
R3411:Grik5 UTSW 7 25062972 missense probably benign 0.04
R3615:Grik5 UTSW 7 25022571 missense probably benign 0.37
R3616:Grik5 UTSW 7 25022571 missense probably benign 0.37
R4600:Grik5 UTSW 7 25068064 missense probably damaging 0.99
R4658:Grik5 UTSW 7 25060727 splice site probably benign
R4735:Grik5 UTSW 7 25058288 missense probably damaging 1.00
R4810:Grik5 UTSW 7 25015497 missense probably damaging 0.98
R5113:Grik5 UTSW 7 25015527 missense probably damaging 1.00
R5120:Grik5 UTSW 7 25010640 missense probably damaging 1.00
R5132:Grik5 UTSW 7 25065204 missense probably benign 0.02
R5173:Grik5 UTSW 7 25062894 missense possibly damaging 0.76
R5186:Grik5 UTSW 7 25015819 missense probably damaging 1.00
R5239:Grik5 UTSW 7 25065470 missense probably damaging 1.00
R5935:Grik5 UTSW 7 25059077 missense possibly damaging 0.78
R6335:Grik5 UTSW 7 25013594 missense probably benign
R6609:Grik5 UTSW 7 25015526 nonsense probably null
R6760:Grik5 UTSW 7 25058939 critical splice donor site probably null
R6821:Grik5 UTSW 7 25046355 missense possibly damaging 0.46
R6822:Grik5 UTSW 7 25046355 missense possibly damaging 0.46
R6824:Grik5 UTSW 7 25046355 missense possibly damaging 0.46
R7173:Grik5 UTSW 7 25068162 missense probably damaging 1.00
R7230:Grik5 UTSW 7 25023070 missense probably damaging 1.00
R7555:Grik5 UTSW 7 25060597 missense probably benign
R7560:Grik5 UTSW 7 25058526 missense probably damaging 0.99
R7571:Grik5 UTSW 7 25013885 missense possibly damaging 0.87
X0017:Grik5 UTSW 7 25060588 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGTTCTCCAACCATGCCTGT -3'
(R):5'- TCTAAAGGAGTATGTGCACCCG -3'

Sequencing Primer
(F):5'- TGTCCAGGAACCGTTGGG -3'
(R):5'- CTCAGCAGTTCAGAGCATTGG -3'
Posted On2018-10-18