Incidental Mutation 'R6820:Pak4'
ID537565
Institutional Source Beutler Lab
Gene Symbol Pak4
Ensembl Gene ENSMUSG00000030602
Gene Namep21 (RAC1) activated kinase 4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6820 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location28558819-28598185 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 28563036 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 384 (Y384H)
Ref Sequence ENSEMBL: ENSMUSP00000103918 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032823] [ENSMUST00000040531] [ENSMUST00000108283]
Predicted Effect probably benign
Transcript: ENSMUST00000032823
AA Change: Y384H

PolyPhen 2 Score 0.344 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000032823
Gene: ENSMUSG00000030602
AA Change: Y384H

DomainStartEndE-ValueType
PBD 11 46 4.07e-14 SMART
low complexity region 238 258 N/A INTRINSIC
low complexity region 267 300 N/A INTRINSIC
S_TKc 323 574 1.21e-90 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000040531
SMART Domains Protein: ENSMUSP00000040486
Gene: ENSMUSG00000109336

DomainStartEndE-ValueType
low complexity region 81 90 N/A INTRINSIC
low complexity region 174 190 N/A INTRINSIC
low complexity region 200 211 N/A INTRINSIC
low complexity region 278 290 N/A INTRINSIC
SAM 296 359 1.02e-9 SMART
low complexity region 406 420 N/A INTRINSIC
low complexity region 433 461 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108283
AA Change: Y384H

PolyPhen 2 Score 0.344 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000103918
Gene: ENSMUSG00000030602
AA Change: Y384H

DomainStartEndE-ValueType
PBD 11 46 4.07e-14 SMART
low complexity region 238 258 N/A INTRINSIC
low complexity region 267 300 N/A INTRINSIC
S_TKc 323 574 1.21e-90 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183983
Meta Mutation Damage Score 0.9134 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] PAK proteins, a family of serine/threonine p21-activating kinases, include PAK1, PAK2, PAK3 and PAK4. PAK proteins are critical effectors that link Rho GTPases to cytoskeleton reorganization and nuclear signaling. They serve as targets for the small GTP binding proteins Cdc42 and Rac and have been implicated in a wide range of biological activities. PAK4 interacts specifically with the GTP-bound form of Cdc42Hs and weakly activates the JNK family of MAP kinases. PAK4 is a mediator of filopodia formation and may play a role in the reorganization of the actin cytoskeleton. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice die at midgestation exhibiting heart defects as well as impaired neuronal development and yolk sac vasculature. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Accs T A 2: 93,842,921 N141Y probably null Het
Chkb A G 15: 89,428,176 L46P probably damaging Het
Col9a3 G A 2: 180,607,134 V260M probably damaging Het
Dna2 T C 10: 62,964,904 I739T possibly damaging Het
Dnah17 T C 11: 118,069,000 H2620R probably damaging Het
Dsel A G 1: 111,859,817 V996A probably damaging Het
Dst T C 1: 34,211,256 L1757S probably damaging Het
Exoc5 A T 14: 49,048,930 probably null Het
Fam120a A T 13: 48,880,992 V1048E possibly damaging Het
Fam213b A T 4: 154,898,166 D50E probably damaging Het
Fam50b G A 13: 34,747,101 E187K possibly damaging Het
Fbxw19 T A 9: 109,482,011 T377S probably benign Het
Fbxw28 A T 9: 109,338,425 F88Y probably damaging Het
Grik5 C T 7: 25,046,355 R431Q possibly damaging Het
Gtsf1 T C 15: 103,420,527 T92A probably benign Het
Hoxc13 A G 15: 102,921,822 Y212C probably damaging Het
Itih2 T C 2: 10,098,098 I742V probably benign Het
Kat7 T C 11: 95,284,139 T351A probably damaging Het
Mlh3 T C 12: 85,247,723 D1233G probably damaging Het
Mroh2b A G 15: 4,953,274 D1525G probably damaging Het
Nme5 T C 18: 34,571,573 Y73C probably damaging Het
Nr3c2 T C 8: 77,242,457 V957A probably damaging Het
Nup153 A G 13: 46,709,983 S301P probably benign Het
Obscn T C 11: 59,051,193 D5013G probably damaging Het
Olfr1278 C T 2: 111,293,110 P281S probably damaging Het
Olfr470 A G 7: 107,845,091 V214A probably benign Het
Olfr919 A G 9: 38,697,475 V297A possibly damaging Het
Pak1 A G 7: 97,886,379 N226D probably benign Het
Pkp3 T C 7: 141,079,844 probably null Het
Psd G T 19: 46,320,844 A558E probably damaging Het
Psmd14 C A 2: 61,776,724 H172N probably benign Het
Pygb G T 2: 150,816,754 W366L possibly damaging Het
Rbm39 A T 2: 156,179,226 M1K probably null Het
Rnf213 T C 11: 119,448,838 I3421T probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Smg6 T C 11: 75,041,964 V88A probably damaging Het
Tha1 T C 11: 117,871,678 E80G probably benign Het
Tie1 A G 4: 118,484,386 V243A probably damaging Het
Tmem215 T C 4: 40,473,926 M1T probably null Het
Tpm2 A G 4: 43,518,443 Y221H probably damaging Het
Ubap1 C T 4: 41,379,854 P356L probably benign Het
Wbp2nl G T 15: 82,313,795 A178S possibly damaging Het
Wdr54 A T 6: 83,154,619 S139T probably benign Het
Wipi2 G C 5: 142,629,800 Q14H probably benign Het
Zan T C 5: 137,407,844 probably benign Het
Zfp735 A G 11: 73,688,957 M1V probably null Het
Other mutations in Pak4
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0025:Pak4 UTSW 7 28564283 missense probably damaging 1.00
R0531:Pak4 UTSW 7 28568054 missense possibly damaging 0.69
R0893:Pak4 UTSW 7 28559777 missense probably benign 0.21
R1108:Pak4 UTSW 7 28560242 missense probably damaging 1.00
R1801:Pak4 UTSW 7 28565190 missense probably damaging 1.00
R1844:Pak4 UTSW 7 28565265 missense possibly damaging 0.88
R3108:Pak4 UTSW 7 28564344 nonsense probably null
R4693:Pak4 UTSW 7 28564249 missense probably damaging 1.00
R5320:Pak4 UTSW 7 28568206 missense probably damaging 0.98
R5357:Pak4 UTSW 7 28564406 missense probably damaging 0.99
R5724:Pak4 UTSW 7 28564580 missense possibly damaging 0.94
R6047:Pak4 UTSW 7 28563036 missense probably benign 0.34
R6161:Pak4 UTSW 7 28565267 missense possibly damaging 0.95
R6241:Pak4 UTSW 7 28565265 missense possibly damaging 0.88
R7262:Pak4 UTSW 7 28565200 missense possibly damaging 0.60
R7338:Pak4 UTSW 7 28564956 missense probably benign 0.37
R7681:Pak4 UTSW 7 28560230 missense probably damaging 1.00
R8709:Pak4 UTSW 7 28562544 missense probably benign 0.02
Z1088:Pak4 UTSW 7 28565228 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GGCACTTGTCTATCACCAGAG -3'
(R):5'- GTATCCCTAGAATGAAGTCGCCC -3'

Sequencing Primer
(F):5'- TTGTCTATCACCAGAGCCTAAAGGG -3'
(R):5'- CTAGAATGAAGTCGCCCACAGG -3'
Posted On2018-10-18