Incidental Mutation 'R6820:Olfr470'
ID537567
Institutional Source Beutler Lab
Gene Symbol Olfr470
Ensembl Gene ENSMUSG00000109542
Gene Nameolfactory receptor 470
SynonymsMOR204-22, GA_x6K02T2PBJ9-10175273-10174329
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.318) question?
Stock #R6820 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location107842905-107847490 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 107845091 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 214 (V214A)
Ref Sequence ENSEMBL: ENSMUSP00000151543 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073059] [ENSMUST00000220193]
Predicted Effect probably benign
Transcript: ENSMUST00000073059
AA Change: V214A

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000072810
Gene: ENSMUSG00000109542
AA Change: V214A

DomainStartEndE-ValueType
Pfam:7tm_4 34 311 2e-56 PFAM
Pfam:7tm_1 44 293 2e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000220193
AA Change: V214A

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
Meta Mutation Damage Score 0.2331 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Accs T A 2: 93,842,921 N141Y probably null Het
Chkb A G 15: 89,428,176 L46P probably damaging Het
Col9a3 G A 2: 180,607,134 V260M probably damaging Het
Dna2 T C 10: 62,964,904 I739T possibly damaging Het
Dnah17 T C 11: 118,069,000 H2620R probably damaging Het
Dsel A G 1: 111,859,817 V996A probably damaging Het
Dst T C 1: 34,211,256 L1757S probably damaging Het
Exoc5 A T 14: 49,048,930 probably null Het
Fam120a A T 13: 48,880,992 V1048E possibly damaging Het
Fam213b A T 4: 154,898,166 D50E probably damaging Het
Fam50b G A 13: 34,747,101 E187K possibly damaging Het
Fbxw19 T A 9: 109,482,011 T377S probably benign Het
Fbxw28 A T 9: 109,338,425 F88Y probably damaging Het
Grik5 C T 7: 25,046,355 R431Q possibly damaging Het
Gtsf1 T C 15: 103,420,527 T92A probably benign Het
Hoxc13 A G 15: 102,921,822 Y212C probably damaging Het
Itih2 T C 2: 10,098,098 I742V probably benign Het
Kat7 T C 11: 95,284,139 T351A probably damaging Het
Mlh3 T C 12: 85,247,723 D1233G probably damaging Het
Mroh2b A G 15: 4,953,274 D1525G probably damaging Het
Nme5 T C 18: 34,571,573 Y73C probably damaging Het
Nr3c2 T C 8: 77,242,457 V957A probably damaging Het
Nup153 A G 13: 46,709,983 S301P probably benign Het
Obscn T C 11: 59,051,193 D5013G probably damaging Het
Olfr1278 C T 2: 111,293,110 P281S probably damaging Het
Olfr919 A G 9: 38,697,475 V297A possibly damaging Het
Pak1 A G 7: 97,886,379 N226D probably benign Het
Pak4 A G 7: 28,563,036 Y384H probably benign Het
Pkp3 T C 7: 141,079,844 probably null Het
Psd G T 19: 46,320,844 A558E probably damaging Het
Psmd14 C A 2: 61,776,724 H172N probably benign Het
Pygb G T 2: 150,816,754 W366L possibly damaging Het
Rbm39 A T 2: 156,179,226 M1K probably null Het
Rnf213 T C 11: 119,448,838 I3421T probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Smg6 T C 11: 75,041,964 V88A probably damaging Het
Tha1 T C 11: 117,871,678 E80G probably benign Het
Tie1 A G 4: 118,484,386 V243A probably damaging Het
Tmem215 T C 4: 40,473,926 M1T probably null Het
Tpm2 A G 4: 43,518,443 Y221H probably damaging Het
Ubap1 C T 4: 41,379,854 P356L probably benign Het
Wbp2nl G T 15: 82,313,795 A178S possibly damaging Het
Wdr54 A T 6: 83,154,619 S139T probably benign Het
Wipi2 G C 5: 142,629,800 Q14H probably benign Het
Zan T C 5: 137,407,844 probably benign Het
Zfp735 A G 11: 73,688,957 M1V probably null Het
Other mutations in Olfr470
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02034:Olfr470 APN 7 107845178 missense probably benign 0.00
IGL02349:Olfr470 APN 7 107845605 missense probably benign 0.03
IGL02365:Olfr470 APN 7 107844912 missense probably damaging 1.00
R0070:Olfr470 UTSW 7 107844917 missense probably damaging 0.99
R0540:Olfr470 UTSW 7 107845569 missense probably damaging 0.98
R0607:Olfr470 UTSW 7 107845569 missense probably damaging 0.98
R0624:Olfr470 UTSW 7 107845116 missense possibly damaging 0.87
R1983:Olfr470 UTSW 7 107845412 missense probably benign 0.36
R2420:Olfr470 UTSW 7 107844818 missense probably benign 0.03
R2441:Olfr470 UTSW 7 107844978 missense probably benign 0.10
R4395:Olfr470 UTSW 7 107845262 missense probably damaging 1.00
R4734:Olfr470 UTSW 7 107845428 missense probably benign 0.00
R4779:Olfr470 UTSW 7 107845548 missense possibly damaging 0.96
R5874:Olfr470 UTSW 7 107845170 missense probably benign
R6598:Olfr470 UTSW 7 107845263 missense probably benign 0.06
R6807:Olfr470 UTSW 7 107845590 missense possibly damaging 0.67
R7305:Olfr470 UTSW 7 107845365 missense probably damaging 1.00
R7413:Olfr470 UTSW 7 107845514 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGACACCACCTTGTTCTGGTC -3'
(R):5'- CTGTATCCAGTTGCTTGTAGGATC -3'

Sequencing Primer
(F):5'- CACCTTGTTCTGGTCCGTGG -3'
(R):5'- CCAGTTGCTTGTAGGATCTTATATTG -3'
Posted On2018-10-18