Incidental Mutation 'R6820:Fbxw28'
ID537571
Institutional Source Beutler Lab
Gene Symbol Fbxw28
Ensembl Gene ENSMUSG00000054087
Gene NameF-box and WD-40 domain protein 28
SynonymsGm9337
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R6820 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location109322886-109339659 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 109338425 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 88 (F88Y)
Ref Sequence ENSEMBL: ENSMUSP00000143357 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112039] [ENSMUST00000112040] [ENSMUST00000196351] [ENSMUST00000200156]
Predicted Effect probably damaging
Transcript: ENSMUST00000112039
AA Change: F88Y

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000107670
Gene: ENSMUSG00000054087
AA Change: F88Y

DomainStartEndE-ValueType
FBOX 5 45 3.13e-6 SMART
SCOP:d1tbga_ 127 249 4e-9 SMART
Blast:WD40 136 175 3e-6 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000112040
AA Change: F88Y

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000107671
Gene: ENSMUSG00000054087
AA Change: F88Y

DomainStartEndE-ValueType
FBOX 5 45 3.13e-6 SMART
SCOP:d1tbga_ 127 249 4e-9 SMART
Blast:WD40 136 175 4e-6 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000196351
AA Change: F88Y

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143357
Gene: ENSMUSG00000054087
AA Change: F88Y

DomainStartEndE-ValueType
FBOX 5 45 2e-8 SMART
SCOP:d1aym1_ 54 102 2e-3 SMART
Blast:WD40 172 211 5e-6 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000200156
AA Change: F88Y

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000143361
Gene: ENSMUSG00000054087
AA Change: F88Y

DomainStartEndE-ValueType
FBOX 5 45 2e-8 SMART
SCOP:d1tbga_ 127 208 2e-3 SMART
Blast:WD40 136 175 4e-6 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 98% (46/47)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Accs T A 2: 93,842,921 N141Y probably null Het
Chkb A G 15: 89,428,176 L46P probably damaging Het
Col9a3 G A 2: 180,607,134 V260M probably damaging Het
Dna2 T C 10: 62,964,904 I739T possibly damaging Het
Dnah17 T C 11: 118,069,000 H2620R probably damaging Het
Dsel A G 1: 111,859,817 V996A probably damaging Het
Dst T C 1: 34,211,256 L1757S probably damaging Het
Exoc5 A T 14: 49,048,930 probably null Het
Fam120a A T 13: 48,880,992 V1048E possibly damaging Het
Fam213b A T 4: 154,898,166 D50E probably damaging Het
Fam50b G A 13: 34,747,101 E187K possibly damaging Het
Fbxw19 T A 9: 109,482,011 T377S probably benign Het
Grik5 C T 7: 25,046,355 R431Q possibly damaging Het
Gtsf1 T C 15: 103,420,527 T92A probably benign Het
Hoxc13 A G 15: 102,921,822 Y212C probably damaging Het
Itih2 T C 2: 10,098,098 I742V probably benign Het
Kat7 T C 11: 95,284,139 T351A probably damaging Het
Mlh3 T C 12: 85,247,723 D1233G probably damaging Het
Mroh2b A G 15: 4,953,274 D1525G probably damaging Het
Nme5 T C 18: 34,571,573 Y73C probably damaging Het
Nr3c2 T C 8: 77,242,457 V957A probably damaging Het
Nup153 A G 13: 46,709,983 S301P probably benign Het
Obscn T C 11: 59,051,193 D5013G probably damaging Het
Olfr1278 C T 2: 111,293,110 P281S probably damaging Het
Olfr470 A G 7: 107,845,091 V214A probably benign Het
Olfr919 A G 9: 38,697,475 V297A possibly damaging Het
Pak1 A G 7: 97,886,379 N226D probably benign Het
Pak4 A G 7: 28,563,036 Y384H probably benign Het
Pkp3 T C 7: 141,079,844 probably null Het
Psd G T 19: 46,320,844 A558E probably damaging Het
Psmd14 C A 2: 61,776,724 H172N probably benign Het
Pygb G T 2: 150,816,754 W366L possibly damaging Het
Rbm39 A T 2: 156,179,226 M1K probably null Het
Rnf213 T C 11: 119,448,838 I3421T probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Smg6 T C 11: 75,041,964 V88A probably damaging Het
Tha1 T C 11: 117,871,678 E80G probably benign Het
Tie1 A G 4: 118,484,386 V243A probably damaging Het
Tmem215 T C 4: 40,473,926 M1T probably null Het
Tpm2 A G 4: 43,518,443 Y221H probably damaging Het
Ubap1 C T 4: 41,379,854 P356L probably benign Het
Wbp2nl G T 15: 82,313,795 A178S possibly damaging Het
Wdr54 A T 6: 83,154,619 S139T probably benign Het
Wipi2 G C 5: 142,629,800 Q14H probably benign Het
Zan T C 5: 137,407,844 probably benign Het
Zfp735 A G 11: 73,688,957 M1V probably null Het
Other mutations in Fbxw28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01883:Fbxw28 APN 9 109328325 missense probably benign 0.05
IGL02080:Fbxw28 APN 9 109339573 missense probably damaging 1.00
IGL02313:Fbxw28 APN 9 109337352 missense possibly damaging 0.76
R0029:Fbxw28 UTSW 9 109328289 missense probably damaging 1.00
R0038:Fbxw28 UTSW 9 109338540 missense probably damaging 1.00
R0058:Fbxw28 UTSW 9 109328211 missense probably benign 0.22
R1288:Fbxw28 UTSW 9 109337293 missense probably damaging 0.97
R1898:Fbxw28 UTSW 9 109323384 missense probably benign 0.32
R2065:Fbxw28 UTSW 9 109328224 missense probably benign 0.03
R2117:Fbxw28 UTSW 9 109330917 missense probably benign 0.04
R3410:Fbxw28 UTSW 9 109338404 missense possibly damaging 0.55
R3812:Fbxw28 UTSW 9 109338530 missense possibly damaging 0.83
R4400:Fbxw28 UTSW 9 109328310 missense probably damaging 1.00
R4840:Fbxw28 UTSW 9 109339534 missense probably null 1.00
R4899:Fbxw28 UTSW 9 109330853 missense probably damaging 0.99
R5129:Fbxw28 UTSW 9 109326603 missense probably damaging 1.00
R5613:Fbxw28 UTSW 9 109338533 missense probably benign 0.02
R5777:Fbxw28 UTSW 9 109338536 missense probably damaging 0.98
R6029:Fbxw28 UTSW 9 109329425 missense probably damaging 1.00
R6235:Fbxw28 UTSW 9 109326190 missense probably damaging 1.00
R6367:Fbxw28 UTSW 9 109339531 critical splice donor site probably null
R6968:Fbxw28 UTSW 9 109330788 missense probably benign 0.00
R7763:Fbxw28 UTSW 9 109326633 missense probably damaging 0.96
RF024:Fbxw28 UTSW 9 109338526 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCCTTCAGGTAAAGGGAACG -3'
(R):5'- CAGCCTGATGGGTTTGCAAC -3'

Sequencing Primer
(F):5'- TGAGCAACCAGTCAGTAGATTAC -3'
(R):5'- CAACTGTGAATTGCAGGAAGTTGTG -3'
Posted On2018-10-18