Incidental Mutation 'R6820:Dna2'
ID537573
Institutional Source Beutler Lab
Gene Symbol Dna2
Ensembl Gene ENSMUSG00000036875
Gene NameDNA replication helicase/nuclease 2
SynonymsE130315B21Rik, Dna2l
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6820 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location62947026-62974185 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 62964904 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 739 (I739T)
Ref Sequence ENSEMBL: ENSMUSP00000115750 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092462] [ENSMUST00000131422]
Predicted Effect possibly damaging
Transcript: ENSMUST00000092462
AA Change: I739T

PolyPhen 2 Score 0.524 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000090119
Gene: ENSMUSG00000036875
AA Change: I739T

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
Pfam:Dna2 68 284 4.7e-75 PFAM
Pfam:PDDEXK_1 125 404 4.3e-13 PFAM
Pfam:AAA_11 626 799 6.7e-42 PFAM
Pfam:AAA_30 626 848 1.1e-15 PFAM
Pfam:AAA_19 633 709 5.7e-9 PFAM
Pfam:AAA_12 806 944 4.1e-20 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000131422
AA Change: I739T

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000115750
Gene: ENSMUSG00000036875
AA Change: I739T

DomainStartEndE-ValueType
low complexity region 4 15 N/A INTRINSIC
Pfam:Dna2 72 283 8.2e-65 PFAM
Pfam:PDDEXK_1 125 404 3e-11 PFAM
Pfam:AAA_11 626 732 7.8e-17 PFAM
Pfam:AAA_30 626 848 1.3e-15 PFAM
Pfam:AAA_19 633 709 6.2e-9 PFAM
Pfam:AAA_11 722 799 1.2e-21 PFAM
Pfam:AAA_12 806 1020 5.3e-57 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DNA2/NAM7 helicase family. The encoded protein is a conserved helicase/nuclease involved in the maintenance of mitochondrial and nuclear DNA stability. Mutations in this gene are associated with autosomal dominant progressive external ophthalmoplegia-6 (PEOA6) and Seckel syndrome 8. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2014]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality before E7.5. Mice heterozygous for the allele exhibit shortened telomeres, chromosome segregation errors and increased tumor incidence associated with aneuploidy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Accs T A 2: 93,842,921 N141Y probably null Het
Chkb A G 15: 89,428,176 L46P probably damaging Het
Col9a3 G A 2: 180,607,134 V260M probably damaging Het
Dnah17 T C 11: 118,069,000 H2620R probably damaging Het
Dsel A G 1: 111,859,817 V996A probably damaging Het
Dst T C 1: 34,211,256 L1757S probably damaging Het
Exoc5 A T 14: 49,048,930 probably null Het
Fam120a A T 13: 48,880,992 V1048E possibly damaging Het
Fam213b A T 4: 154,898,166 D50E probably damaging Het
Fam50b G A 13: 34,747,101 E187K possibly damaging Het
Fbxw19 T A 9: 109,482,011 T377S probably benign Het
Fbxw28 A T 9: 109,338,425 F88Y probably damaging Het
Grik5 C T 7: 25,046,355 R431Q possibly damaging Het
Gtsf1 T C 15: 103,420,527 T92A probably benign Het
Hoxc13 A G 15: 102,921,822 Y212C probably damaging Het
Itih2 T C 2: 10,098,098 I742V probably benign Het
Kat7 T C 11: 95,284,139 T351A probably damaging Het
Mlh3 T C 12: 85,247,723 D1233G probably damaging Het
Mroh2b A G 15: 4,953,274 D1525G probably damaging Het
Nme5 T C 18: 34,571,573 Y73C probably damaging Het
Nr3c2 T C 8: 77,242,457 V957A probably damaging Het
Nup153 A G 13: 46,709,983 S301P probably benign Het
Obscn T C 11: 59,051,193 D5013G probably damaging Het
Olfr1278 C T 2: 111,293,110 P281S probably damaging Het
Olfr470 A G 7: 107,845,091 V214A probably benign Het
Olfr919 A G 9: 38,697,475 V297A possibly damaging Het
Pak1 A G 7: 97,886,379 N226D probably benign Het
Pak4 A G 7: 28,563,036 Y384H probably benign Het
Pkp3 T C 7: 141,079,844 probably null Het
Psd G T 19: 46,320,844 A558E probably damaging Het
Psmd14 C A 2: 61,776,724 H172N probably benign Het
Pygb G T 2: 150,816,754 W366L possibly damaging Het
Rbm39 A T 2: 156,179,226 M1K probably null Het
Rnf213 T C 11: 119,448,838 I3421T probably damaging Het
Rsf1 ATGGCG ATGGCGACGGTGGCG 7: 97,579,904 probably benign Het
Smg6 T C 11: 75,041,964 V88A probably damaging Het
Tha1 T C 11: 117,871,678 E80G probably benign Het
Tie1 A G 4: 118,484,386 V243A probably damaging Het
Tmem215 T C 4: 40,473,926 M1T probably null Het
Tpm2 A G 4: 43,518,443 Y221H probably damaging Het
Ubap1 C T 4: 41,379,854 P356L probably benign Het
Wbp2nl G T 15: 82,313,795 A178S possibly damaging Het
Wdr54 A T 6: 83,154,619 S139T probably benign Het
Wipi2 G C 5: 142,629,800 Q14H probably benign Het
Zan T C 5: 137,407,844 probably benign Het
Zfp735 A G 11: 73,688,957 M1V probably null Het
Other mutations in Dna2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00329:Dna2 APN 10 62966443 missense probably damaging 1.00
IGL00972:Dna2 APN 10 62950823 missense probably benign 0.13
IGL01511:Dna2 APN 10 62955314 missense possibly damaging 0.69
IGL01600:Dna2 APN 10 62950806 missense probably damaging 0.96
IGL02016:Dna2 APN 10 62960412 missense probably benign 0.00
IGL02049:Dna2 APN 10 62957036 missense probably damaging 0.99
IGL02069:Dna2 APN 10 62958994 missense probably benign 0.00
IGL02438:Dna2 APN 10 62957062 missense possibly damaging 0.92
IGL02743:Dna2 APN 10 62957042 missense possibly damaging 0.90
IGL02800:Dna2 APN 10 62961725 critical splice donor site probably null
IGL02936:Dna2 APN 10 62957100 missense probably damaging 1.00
supercoiled UTSW 10 62971993 splice site probably null
R0308:Dna2 UTSW 10 62956974 missense probably damaging 0.98
R0528:Dna2 UTSW 10 62958131 missense probably benign 0.00
R0669:Dna2 UTSW 10 62956989 missense probably damaging 1.00
R0697:Dna2 UTSW 10 62949341 missense probably benign 0.01
R0831:Dna2 UTSW 10 62959329 nonsense probably null
R0839:Dna2 UTSW 10 62969782 missense probably damaging 1.00
R0991:Dna2 UTSW 10 62949187 missense probably benign 0.08
R0992:Dna2 UTSW 10 62949187 missense probably benign 0.08
R1054:Dna2 UTSW 10 62963823 missense possibly damaging 0.84
R1082:Dna2 UTSW 10 62949187 missense probably benign 0.08
R1084:Dna2 UTSW 10 62949187 missense probably benign 0.08
R1184:Dna2 UTSW 10 62959198 missense probably benign 0.00
R1193:Dna2 UTSW 10 62949187 missense probably benign 0.08
R1196:Dna2 UTSW 10 62949187 missense probably benign 0.08
R1226:Dna2 UTSW 10 62960424 missense possibly damaging 0.88
R1561:Dna2 UTSW 10 62949187 missense probably benign 0.08
R1562:Dna2 UTSW 10 62949187 missense probably benign 0.08
R1566:Dna2 UTSW 10 62949187 missense probably benign 0.08
R1568:Dna2 UTSW 10 62949187 missense probably benign 0.08
R1598:Dna2 UTSW 10 62961657 missense probably damaging 0.99
R1768:Dna2 UTSW 10 62957084 missense probably benign 0.01
R2075:Dna2 UTSW 10 62969822 missense probably benign 0.20
R3125:Dna2 UTSW 10 62949202 missense possibly damaging 0.66
R3763:Dna2 UTSW 10 62966797 missense probably damaging 1.00
R4059:Dna2 UTSW 10 62956989 missense probably damaging 1.00
R5002:Dna2 UTSW 10 62950842 missense probably damaging 1.00
R5160:Dna2 UTSW 10 62947154 missense probably benign
R5567:Dna2 UTSW 10 62966673 missense possibly damaging 0.89
R5775:Dna2 UTSW 10 62949242 missense possibly damaging 0.94
R5984:Dna2 UTSW 10 62962506 critical splice donor site probably null
R6604:Dna2 UTSW 10 62967743 critical splice donor site probably null
R6702:Dna2 UTSW 10 62973294 missense possibly damaging 0.89
R6703:Dna2 UTSW 10 62973294 missense possibly damaging 0.89
R6812:Dna2 UTSW 10 62959341 missense probably benign 0.18
R6919:Dna2 UTSW 10 62957003 missense probably damaging 1.00
R7029:Dna2 UTSW 10 62963994 missense probably damaging 1.00
R7082:Dna2 UTSW 10 62954317 missense possibly damaging 0.71
R7508:Dna2 UTSW 10 62971993 splice site probably null
R7513:Dna2 UTSW 10 62971968 missense probably benign 0.00
R7605:Dna2 UTSW 10 62960275 missense probably benign 0.02
R7742:Dna2 UTSW 10 62973294 missense probably benign 0.31
R7868:Dna2 UTSW 10 62969864 missense probably benign 0.00
R7983:Dna2 UTSW 10 62955394 missense probably benign 0.04
R8498:Dna2 UTSW 10 62973315 missense probably benign 0.12
R8508:Dna2 UTSW 10 62950894 missense probably damaging 1.00
RF007:Dna2 UTSW 10 62966695 missense probably damaging 0.99
Z1177:Dna2 UTSW 10 62962424 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GCATATATGGCTTCCTGGTCTC -3'
(R):5'- TTTACAACCAGGGGAGGCAG -3'

Sequencing Primer
(F):5'- TTAGACCCAGCAGTTTCAGG -3'
(R):5'- AGGCAGCTGCTGATGGTC -3'
Posted On2018-10-18